GGRNA ver.2 Help | Advanced search | Japanese    Previous release (v1)

2020-12-01 21:07:17, GGRNA : RefSeq release 202 (Sep, 2020)

Summary:

Results:

Matches are highlighted with green background. Overlapping matches are dark colored.

Homo sapiens paternally expressed 3 (PEG3), transcript variant 24, mRNA. (8277 bp)
gttttggtaataaattttatgtatgtattttccattacaaatataatacatactcatacaaaactttggaaattcagtaaagaaaattcacacatattcccaacacccaacaacaattaactgttaacatcttgatctgtgcactagtctgtgattattagggtgttagtgataagtatgcataaatgtcaaagatgggaagaaagatgaaaaacaagaaatagttgtgtggttgttgtgggattatggttattttgtttcggtttccttgaaaggtcatcattctagtgttttggtagtccacctttactacatatatttccattatatatgaaatgtgttcattatagaaactttgaagttacagaaatgtagaagagaaactcacccatgttttcaccatccaaagagtgtggttaacatcttgatatattttcttcatcttgtttctgtgcacaggtttttggtttgttaatatggttgtggtcattctatctgtaatagtgtcaacaataaaaataaagttaaaaataaa
position 7840 7870 7960 7998 8012 8026 8040 8119 8130 8191 8221
Synonym: PW1; ZKSCAN22; ZNF904; ZSCAN24
NM_001369735.1 - Homo sapiens (human) - NCBI - UCSC - RefEx(expression)
Homo sapiens paternally expressed 3 (PEG3), transcript variant 22, mRNA. (8282 bp)
gttttggtaataaattttatgtatgtattttccattacaaatataatacatactcatacaaaactttggaaattcagtaaagaaaattcacacatattcccaacacccaacaacaattaactgttaacatcttgatctgtgcactagtctgtgattattagggtgttagtgataagtatgcataaatgtcaaagatgggaagaaagatgaaaaacaagaaatagttgtgtggttgttgtgggattatggttattttgtttcggtttccttgaaaggtcatcattctagtgttttggtagtccacctttactacatatatttccattatatatgaaatgtgttcattatagaaactttgaagttacagaaatgtagaagagaaactcacccatgttttcaccatccaaagagtgtggttaacatcttgatatattttcttcatcttgtttctgtgcacaggtttttggtttgttaatatggttgtggtcattctatctgtaatagtgtcaacaataaaaataaagttaaaaataaa
position 7845 7875 7965 8003 8017 8031 8045 8124 8135 8196 8226
Synonym: PW1; ZKSCAN22; ZNF904; ZSCAN24
NM_001369733.1 - Homo sapiens (human) - NCBI - UCSC - RefEx(expression)
Homo sapiens paternally expressed 3 (PEG3), transcript variant 26, mRNA. (8348 bp)
gttttggtaataaattttatgtatgtattttccattacaaatataatacatactcatacaaaactttggaaattcagtaaagaaaattcacacatattcccaacacccaacaacaattaactgttaacatcttgatctgtgcactagtctgtgattattagggtgttagtgataagtatgcataaatgtcaaagatgggaagaaagatgaaaaacaagaaatagttgtgtggttgttgtgggattatggttattttgtttcggtttccttgaaaggtcatcattctagtgttttggtagtccacctttactacatatatttccattatatatgaaatgtgttcattatagaaactttgaagttacagaaatgtagaagagaaactcacccatgttttcaccatccaaagagtgtggttaacatcttgatatattttcttcatcttgtttctgtgcacaggtttttggtttgttaatatggttgtggtcattctatctgtaatagtgtcaacaataaaaataaagttaaaaataaa
position 7911 7941 8031 8069 8083 8097 8111 8190 8201 8262 8292
Synonym: PW1; ZKSCAN22; ZNF904; ZSCAN24
NM_001369737.1 - Homo sapiens (human) - NCBI - UCSC - RefEx(expression)
Homo sapiens paternally expressed 3 (PEG3), transcript variant 23, mRNA. (8353 bp)
gttttggtaataaattttatgtatgtattttccattacaaatataatacatactcatacaaaactttggaaattcagtaaagaaaattcacacatattcccaacacccaacaacaattaactgttaacatcttgatctgtgcactagtctgtgattattagggtgttagtgataagtatgcataaatgtcaaagatgggaagaaagatgaaaaacaagaaatagttgtgtggttgttgtgggattatggttattttgtttcggtttccttgaaaggtcatcattctagtgttttggtagtccacctttactacatatatttccattatatatgaaatgtgttcattatagaaactttgaagttacagaaatgtagaagagaaactcacccatgttttcaccatccaaagagtgtggttaacatcttgatatattttcttcatcttgtttctgtgcacaggtttttggtttgttaatatggttgtggtcattctatctgtaatagtgtcaacaataaaaataaagttaaaaataaa
position 7916 7946 8036 8074 8088 8102 8116 8195 8206 8267 8297
Synonym: PW1; ZKSCAN22; ZNF904; ZSCAN24
NM_001369734.1 - Homo sapiens (human) - NCBI - UCSC - RefEx(expression)
Homo sapiens paternally expressed 3 (PEG3), transcript variant 3, mRNA. (8364 bp)
gttttggtaataaattttatgtatgtattttccattacaaatataatacatactcatacaaaactttggaaattcagtaaagaaaattcacacatattcccaacacccaacaacaattaactgttaacatcttgatctgtgcactagtctgtgattattagggtgttagtgataagtatgcataaatgtcaaagatgggaagaaagatgaaaaacaagaaatagttgtgtggttgttgtgggattatggttattttgtttcggtttccttgaaaggtcatcattctagtgttttggtagtccacctttactacatatatttccattatatatgaaatgtgttcattatagaaactttgaagttacagaaatgtagaagagaaactcacccatgttttcaccatccaaagagtgtggttaacatcttgatatattttcttcatcttgtttctgtgcacaggtttttggtttgttaatatggttgtggtcattctatctgtaatagtgtcaacaataaaaataaagttaaaaataaa
position 7927 7957 8047 8085 8099 8113 8127 8206 8217 8278 8308
Synonym: PW1; ZKSCAN22; ZNF904; ZSCAN24
NM_001146185.2 - Homo sapiens (human) - NCBI - UCSC - RefEx(expression)
Homo sapiens paternally expressed 3 (PEG3), transcript variant 25, mRNA. (8364 bp)
gttttggtaataaattttatgtatgtattttccattacaaatataatacatactcatacaaaactttggaaattcagtaaagaaaattcacacatattcccaacacccaacaacaattaactgttaacatcttgatctgtgcactagtctgtgattattagggtgttagtgataagtatgcataaatgtcaaagatgggaagaaagatgaaaaacaagaaatagttgtgtggttgttgtgggattatggttattttgtttcggtttccttgaaaggtcatcattctagtgttttggtagtccacctttactacatatatttccattatatatgaaatgtgttcattatagaaactttgaagttacagaaatgtagaagagaaactcacccatgttttcaccatccaaagagtgtggttaacatcttgatatattttcttcatcttgtttctgtgcacaggtttttggtttgttaatatggttgtggtcattctatctgtaatagtgtcaacaataaaaataaagttaaaaataaa
position 7927 7957 8047 8085 8099 8113 8127 8206 8217 8278 8308
Synonym: PW1; ZKSCAN22; ZNF904; ZSCAN24
NM_001369736.1 - Homo sapiens (human) - NCBI - UCSC - RefEx(expression)
Homo sapiens paternally expressed 3 (PEG3), transcript variant 14, mRNA. (8365 bp)
gttttggtaataaattttatgtatgtattttccattacaaatataatacatactcatacaaaactttggaaattcagtaaagaaaattcacacatattcccaacacccaacaacaattaactgttaacatcttgatctgtgcactagtctgtgattattagggtgttagtgataagtatgcataaatgtcaaagatgggaagaaagatgaaaaacaagaaatagttgtgtggttgttgtgggattatggttattttgtttcggtttccttgaaaggtcatcattctagtgttttggtagtccacctttactacatatatttccattatatatgaaatgtgttcattatagaaactttgaagttacagaaatgtagaagagaaactcacccatgttttcaccatccaaagagtgtggttaacatcttgatatattttcttcatcttgtttctgtgcacaggtttttggtttgttaatatggttgtggtcattctatctgtaatagtgtcaacaataaaaataaagttaaaaataaa
position 7928 7958 8048 8086 8100 8114 8128 8207 8218 8279 8309
Synonym: PW1; ZKSCAN22; ZNF904; ZSCAN24
NM_001369725.1 - Homo sapiens (human) - NCBI - UCSC - RefEx(expression)
Homo sapiens paternally expressed 3 (PEG3), transcript variant 5, mRNA. (8370 bp)
gttttggtaataaattttatgtatgtattttccattacaaatataatacatactcatacaaaactttggaaattcagtaaagaaaattcacacatattcccaacacccaacaacaattaactgttaacatcttgatctgtgcactagtctgtgattattagggtgttagtgataagtatgcataaatgtcaaagatgggaagaaagatgaaaaacaagaaatagttgtgtggttgttgtgggattatggttattttgtttcggtttccttgaaaggtcatcattctagtgttttggtagtccacctttactacatatatttccattatatatgaaatgtgttcattatagaaactttgaagttacagaaatgtagaagagaaactcacccatgttttcaccatccaaagagtgtggttaacatcttgatatattttcttcatcttgtttctgtgcacaggtttttggtttgttaatatggttgtggtcattctatctgtaatagtgtcaacaataaaaataaagttaaaaataaa
position 7933 7963 8053 8091 8105 8119 8133 8212 8223 8284 8314
Synonym: PW1; ZKSCAN22; ZNF904; ZSCAN24
NM_001146187.2 - Homo sapiens (human) - NCBI - UCSC - RefEx(expression)
Homo sapiens paternally expressed 3 (PEG3), transcript variant 11, mRNA. (8441 bp)
gttttggtaataaattttatgtatgtattttccattacaaatataatacatactcatacaaaactttggaaattcagtaaagaaaattcacacatattcccaacacccaacaacaattaactgttaacatcttgatctgtgcactagtctgtgattattagggtgttagtgataagtatgcataaatgtcaaagatgggaagaaagatgaaaaacaagaaatagttgtgtggttgttgtgggattatggttattttgtttcggtttccttgaaaggtcatcattctagtgttttggtagtccacctttactacatatatttccattatatatgaaatgtgttcattatagaaactttgaagttacagaaatgtagaagagaaactcacccatgttttcaccatccaaagagtgtggttaacatcttgatatattttcttcatcttgtttctgtgcacaggtttttggtttgttaatatggttgtggtcattctatctgtaatagtgtcaacaataaaaataaagttaaaaataaa
position 8004 8034 8124 8162 8176 8190 8204 8283 8294 8355 8385
Synonym: PW1; ZKSCAN22; ZNF904; ZSCAN24
NM_001369722.1 - Homo sapiens (human) - NCBI - UCSC - RefEx(expression)
Homo sapiens paternally expressed 3 (PEG3), transcript variant 30, mRNA. (8446 bp)
gttttggtaataaattttatgtatgtattttccattacaaatataatacatactcatacaaaactttggaaattcagtaaagaaaattcacacatattcccaacacccaacaacaattaactgttaacatcttgatctgtgcactagtctgtgattattagggtgttagtgataagtatgcataaatgtcaaagatgggaagaaagatgaaaaacaagaaatagttgtgtggttgttgtgggattatggttattttgtttcggtttccttgaaaggtcatcattctagtgttttggtagtccacctttactacatatatttccattatatatgaaatgtgttcattatagaaactttgaagttacagaaatgtagaagagaaactcacccatgttttcaccatccaaagagtgtggttaacatcttgatatattttcttcatcttgtttctgtgcacaggtttttggtttgttaatatggttgtggtcattctatctgtaatagtgtcaacaataaaaataaagttaaaaataaa
position 8009 8039 8129 8167 8181 8195 8209 8288 8299 8360 8390
Synonym: PW1; ZKSCAN22; ZNF904; ZSCAN24
NM_001369739.1 - Homo sapiens (human) - NCBI - UCSC - RefEx(expression)
Homo sapiens paternally expressed 3 (PEG3), transcript variant 10, mRNA. (8452 bp)
gttttggtaataaattttatgtatgtattttccattacaaatataatacatactcatacaaaactttggaaattcagtaaagaaaattcacacatattcccaacacccaacaacaattaactgttaacatcttgatctgtgcactagtctgtgattattagggtgttagtgataagtatgcataaatgtcaaagatgggaagaaagatgaaaaacaagaaatagttgtgtggttgttgtgggattatggttattttgtttcggtttccttgaaaggtcatcattctagtgttttggtagtccacctttactacatatatttccattatatatgaaatgtgttcattatagaaactttgaagttacagaaatgtagaagagaaactcacccatgttttcaccatccaaagagtgtggttaacatcttgatatattttcttcatcttgtttctgtgcacaggtttttggtttgttaatatggttgtggtcattctatctgtaatagtgtcaacaataaaaataaagttaaaaataaa
position 8015 8045 8135 8173 8187 8201 8215 8294 8305 8366 8396
Synonym: PW1; ZKSCAN22; ZNF904; ZSCAN24
NM_001369721.1 - Homo sapiens (human) - NCBI - UCSC - RefEx(expression)
Homo sapiens paternally expressed 3 (PEG3), transcript variant 27, mRNA. (8484 bp)
gttttggtaataaattttatgtatgtattttccattacaaatataatacatactcatacaaaactttggaaattcagtaaagaaaattcacacatattcccaacacccaacaacaattaactgttaacatcttgatctgtgcactagtctgtgattattagggtgttagtgataagtatgcataaatgtcaaagatgggaagaaagatgaaaaacaagaaatagttgtgtggttgttgtgggattatggttattttgtttcggtttccttgaaaggtcatcattctagtgttttggtagtccacctttactacatatatttccattatatatgaaatgtgttcattatagaaactttgaagttacagaaatgtagaagagaaactcacccatgttttcaccatccaaagagtgtggttaacatcttgatatattttcttcatcttgtttctgtgcacaggtttttggtttgttaatatggttgtggtcattctatctgtaatagtgtcaacaataaaaataaagttaaaaataaa
position 8047 8077 8167 8205 8219 8233 8247 8326 8337 8398 8428
Synonym: PW1; ZKSCAN22; ZNF904; ZSCAN24
NM_001369738.1 - Homo sapiens (human) - NCBI - UCSC - RefEx(expression)
Homo sapiens paternally expressed 3 (PEG3), transcript variant 19, mRNA. (8501 bp)
gttttggtaataaattttatgtatgtattttccattacaaatataatacatactcatacaaaactttggaaattcagtaaagaaaattcacacatattcccaacacccaacaacaattaactgttaacatcttgatctgtgcactagtctgtgattattagggtgttagtgataagtatgcataaatgtcaaagatgggaagaaagatgaaaaacaagaaatagttgtgtggttgttgtgggattatggttattttgtttcggtttccttgaaaggtcatcattctagtgttttggtagtccacctttactacatatatttccattatatatgaaatgtgttcattatagaaactttgaagttacagaaatgtagaagagaaactcacccatgttttcaccatccaaagagtgtggttaacatcttgatatattttcttcatcttgtttctgtgcacaggtttttggtttgttaatatggttgtggtcattctatctgtaatagtgtcaacaataaaaataaagttaaaaataaa
position 8064 8094 8184 8222 8236 8250 8264 8343 8354 8415 8445
Synonym: PW1; ZKSCAN22; ZNF904; ZSCAN24
NM_001369730.1 - Homo sapiens (human) - NCBI - UCSC - RefEx(expression)
Homo sapiens paternally expressed 3 (PEG3), transcript variant 21, mRNA. (8528 bp)
gttttggtaataaattttatgtatgtattttccattacaaatataatacatactcatacaaaactttggaaattcagtaaagaaaattcacacatattcccaacacccaacaacaattaactgttaacatcttgatctgtgcactagtctgtgattattagggtgttagtgataagtatgcataaatgtcaaagatgggaagaaagatgaaaaacaagaaatagttgtgtggttgttgtgggattatggttattttgtttcggtttccttgaaaggtcatcattctagtgttttggtagtccacctttactacatatatttccattatatatgaaatgtgttcattatagaaactttgaagttacagaaatgtagaagagaaactcacccatgttttcaccatccaaagagtgtggttaacatcttgatatattttcttcatcttgtttctgtgcacaggtttttggtttgttaatatggttgtggtcattctatctgtaatagtgtcaacaataaaaataaagttaaaaataaa
position 8091 8121 8211 8249 8263 8277 8291 8370 8381 8442 8472
Synonym: PW1; ZKSCAN22; ZNF904; ZSCAN24
NM_001369732.1 - Homo sapiens (human) - NCBI - UCSC - RefEx(expression)
Homo sapiens paternally expressed 3 (PEG3), transcript variant 16, mRNA. (8531 bp)
gttttggtaataaattttatgtatgtattttccattacaaatataatacatactcatacaaaactttggaaattcagtaaagaaaattcacacatattcccaacacccaacaacaattaactgttaacatcttgatctgtgcactagtctgtgattattagggtgttagtgataagtatgcataaatgtcaaagatgggaagaaagatgaaaaacaagaaatagttgtgtggttgttgtgggattatggttattttgtttcggtttccttgaaaggtcatcattctagtgttttggtagtccacctttactacatatatttccattatatatgaaatgtgttcattatagaaactttgaagttacagaaatgtagaagagaaactcacccatgttttcaccatccaaagagtgtggttaacatcttgatatattttcttcatcttgtttctgtgcacaggtttttggtttgttaatatggttgtggtcattctatctgtaatagtgtcaacaataaaaataaagttaaaaataaa
position 8094 8124 8214 8252 8266 8280 8294 8373 8384 8445 8475
Synonym: PW1; ZKSCAN22; ZNF904; ZSCAN24
NM_001369727.1 - Homo sapiens (human) - NCBI - UCSC - RefEx(expression)
Homo sapiens paternally expressed 3 (PEG3), transcript variant 18, mRNA. (8533 bp)
gttttggtaataaattttatgtatgtattttccattacaaatataatacatactcatacaaaactttggaaattcagtaaagaaaattcacacatattcccaacacccaacaacaattaactgttaacatcttgatctgtgcactagtctgtgattattagggtgttagtgataagtatgcataaatgtcaaagatgggaagaaagatgaaaaacaagaaatagttgtgtggttgttgtgggattatggttattttgtttcggtttccttgaaaggtcatcattctagtgttttggtagtccacctttactacatatatttccattatatatgaaatgtgttcattatagaaactttgaagttacagaaatgtagaagagaaactcacccatgttttcaccatccaaagagtgtggttaacatcttgatatattttcttcatcttgtttctgtgcacaggtttttggtttgttaatatggttgtggtcattctatctgtaatagtgtcaacaataaaaataaagttaaaaataaa
position 8096 8126 8216 8254 8268 8282 8296 8375 8386 8447 8477
Synonym: PW1; ZKSCAN22; ZNF904; ZSCAN24
NM_001369729.1 - Homo sapiens (human) - NCBI - UCSC - RefEx(expression)
Homo sapiens paternally expressed 3 (PEG3), transcript variant 12, mRNA. (8559 bp)
gttttggtaataaattttatgtatgtattttccattacaaatataatacatactcatacaaaactttggaaattcagtaaagaaaattcacacatattcccaacacccaacaacaattaactgttaacatcttgatctgtgcactagtctgtgattattagggtgttagtgataagtatgcataaatgtcaaagatgggaagaaagatgaaaaacaagaaatagttgtgtggttgttgtgggattatggttattttgtttcggtttccttgaaaggtcatcattctagtgttttggtagtccacctttactacatatatttccattatatatgaaatgtgttcattatagaaactttgaagttacagaaatgtagaagagaaactcacccatgttttcaccatccaaagagtgtggttaacatcttgatatattttcttcatcttgtttctgtgcacaggtttttggtttgttaatatggttgtggtcattctatctgtaatagtgtcaacaataaaaataaagttaaaaataaa
position 8122 8152 8242 8280 8294 8308 8322 8401 8412 8473 8503
Synonym: PW1; ZKSCAN22; ZNF904; ZSCAN24
NM_001369723.1 - Homo sapiens (human) - NCBI - UCSC - RefEx(expression)
Homo sapiens paternally expressed 3 (PEG3), transcript variant 20, mRNA. (8577 bp)
gttttggtaataaattttatgtatgtattttccattacaaatataatacatactcatacaaaactttggaaattcagtaaagaaaattcacacatattcccaacacccaacaacaattaactgttaacatcttgatctgtgcactagtctgtgattattagggtgttagtgataagtatgcataaatgtcaaagatgggaagaaagatgaaaaacaagaaatagttgtgtggttgttgtgggattatggttattttgtttcggtttccttgaaaggtcatcattctagtgttttggtagtccacctttactacatatatttccattatatatgaaatgtgttcattatagaaactttgaagttacagaaatgtagaagagaaactcacccatgttttcaccatccaaagagtgtggttaacatcttgatatattttcttcatcttgtttctgtgcacaggtttttggtttgttaatatggttgtggtcattctatctgtaatagtgtcaacaataaaaataaagttaaaaataaa
position 8140 8170 8260 8298 8312 8326 8340 8419 8430 8491 8521
Synonym: PW1; ZKSCAN22; ZNF904; ZSCAN24
NM_001369731.1 - Homo sapiens (human) - NCBI - UCSC - RefEx(expression)
Homo sapiens paternally expressed 3 (PEG3), transcript variant 17, mRNA. (8585 bp)
gttttggtaataaattttatgtatgtattttccattacaaatataatacatactcatacaaaactttggaaattcagtaaagaaaattcacacatattcccaacacccaacaacaattaactgttaacatcttgatctgtgcactagtctgtgattattagggtgttagtgataagtatgcataaatgtcaaagatgggaagaaagatgaaaaacaagaaatagttgtgtggttgttgtgggattatggttattttgtttcggtttccttgaaaggtcatcattctagtgttttggtagtccacctttactacatatatttccattatatatgaaatgtgttcattatagaaactttgaagttacagaaatgtagaagagaaactcacccatgttttcaccatccaaagagtgtggttaacatcttgatatattttcttcatcttgtttctgtgcacaggtttttggtttgttaatatggttgtggtcattctatctgtaatagtgtcaacaataaaaataaagttaaaaataaa
position 8148 8178 8268 8306 8320 8334 8348 8427 8438 8499 8529
Synonym: PW1; ZKSCAN22; ZNF904; ZSCAN24
NM_001369728.1 - Homo sapiens (human) - NCBI - UCSC - RefEx(expression)
Homo sapiens paternally expressed 3 (PEG3), transcript variant 15, mRNA. (8622 bp)
gttttggtaataaattttatgtatgtattttccattacaaatataatacatactcatacaaaactttggaaattcagtaaagaaaattcacacatattcccaacacccaacaacaattaactgttaacatcttgatctgtgcactagtctgtgattattagggtgttagtgataagtatgcataaatgtcaaagatgggaagaaagatgaaaaacaagaaatagttgtgtggttgttgtgggattatggttattttgtttcggtttccttgaaaggtcatcattctagtgttttggtagtccacctttactacatatatttccattatatatgaaatgtgttcattatagaaactttgaagttacagaaatgtagaagagaaactcacccatgttttcaccatccaaagagtgtggttaacatcttgatatattttcttcatcttgtttctgtgcacaggtttttggtttgttaatatggttgtggtcattctatctgtaatagtgtcaacaataaaaataaagttaaaaataaa
position 8185 8215 8305 8343 8357 8371 8385 8464 8475 8536 8566
Synonym: PW1; ZKSCAN22; ZNF904; ZSCAN24
NM_001369726.1 - Homo sapiens (human) - NCBI - UCSC - RefEx(expression)
Homo sapiens paternally expressed 3 (PEG3), transcript variant 8, mRNA. (8667 bp)
gttttggtaataaattttatgtatgtattttccattacaaatataatacatactcatacaaaactttggaaattcagtaaagaaaattcacacatattcccaacacccaacaacaattaactgttaacatcttgatctgtgcactagtctgtgattattagggtgttagtgataagtatgcataaatgtcaaagatgggaagaaagatgaaaaacaagaaatagttgtgtggttgttgtgggattatggttattttgtttcggtttccttgaaaggtcatcattctagtgttttggtagtccacctttactacatatatttccattatatatgaaatgtgttcattatagaaactttgaagttacagaaatgtagaagagaaactcacccatgttttcaccatccaaagagtgtggttaacatcttgatatattttcttcatcttgtttctgtgcacaggtttttggtttgttaatatggttgtggtcattctatctgtaatagtgtcaacaataaaaataaagttaaaaataaa
position 8230 8260 8350 8388 8402 8416 8430 8509 8520 8581 8611
Synonym: PW1; ZKSCAN22; ZNF904; ZSCAN24
NM_001369719.1 - Homo sapiens (human) - NCBI - UCSC - RefEx(expression)
Homo sapiens paternally expressed 3 (PEG3), transcript variant 2, mRNA. (8678 bp)
gttttggtaataaattttatgtatgtattttccattacaaatataatacatactcatacaaaactttggaaattcagtaaagaaaattcacacatattcccaacacccaacaacaattaactgttaacatcttgatctgtgcactagtctgtgattattagggtgttagtgataagtatgcataaatgtcaaagatgggaagaaagatgaaaaacaagaaatagttgtgtggttgttgtgggattatggttattttgtttcggtttccttgaaaggtcatcattctagtgttttggtagtccacctttactacatatatttccattatatatgaaatgtgttcattatagaaactttgaagttacagaaatgtagaagagaaactcacccatgttttcaccatccaaagagtgtggttaacatcttgatatattttcttcatcttgtttctgtgcacaggtttttggtttgttaatatggttgtggtcattctatctgtaatagtgtcaacaataaaaataaagttaaaaataaa
position 8241 8271 8361 8399 8413 8427 8441 8520 8531 8592 8622
Synonym: PW1; ZKSCAN22; ZNF904; ZSCAN24
NM_001146184.2 - Homo sapiens (human) - NCBI - UCSC - RefEx(expression)
Homo sapiens paternally expressed 3 (PEG3), transcript variant 6, mRNA. (8679 bp)
gttttggtaataaattttatgtatgtattttccattacaaatataatacatactcatacaaaactttggaaattcagtaaagaaaattcacacatattcccaacacccaacaacaattaactgttaacatcttgatctgtgcactagtctgtgattattagggtgttagtgataagtatgcataaatgtcaaagatgggaagaaagatgaaaaacaagaaatagttgtgtggttgttgtgggattatggttattttgtttcggtttccttgaaaggtcatcattctagtgttttggtagtccacctttactacatatatttccattatatatgaaatgtgttcattatagaaactttgaagttacagaaatgtagaagagaaactcacccatgttttcaccatccaaagagtgtggttaacatcttgatatattttcttcatcttgtttctgtgcacaggtttttggtttgttaatatggttgtggtcattctatctgtaatagtgtcaacaataaaaataaagttaaaaataaa
position 8242 8272 8362 8400 8414 8428 8442 8521 8532 8593 8623
Synonym: PW1; ZKSCAN22; ZNF904; ZSCAN24
NM_001369717.1 - Homo sapiens (human) - NCBI - UCSC - RefEx(expression)
Homo sapiens paternally expressed 3 (PEG3), transcript variant 9, mRNA. (8693 bp)
gttttggtaataaattttatgtatgtattttccattacaaatataatacatactcatacaaaactttggaaattcagtaaagaaaattcacacatattcccaacacccaacaacaattaactgttaacatcttgatctgtgcactagtctgtgattattagggtgttagtgataagtatgcataaatgtcaaagatgggaagaaagatgaaaaacaagaaatagttgtgtggttgttgtgggattatggttattttgtttcggtttccttgaaaggtcatcattctagtgttttggtagtccacctttactacatatatttccattatatatgaaatgtgttcattatagaaactttgaagttacagaaatgtagaagagaaactcacccatgttttcaccatccaaagagtgtggttaacatcttgatatattttcttcatcttgtttctgtgcacaggtttttggtttgttaatatggttgtggtcattctatctgtaatagtgtcaacaataaaaataaagttaaaaataaa
position 8256 8286 8376 8414 8428 8442 8456 8535 8546 8607 8637
Synonym: PW1; ZKSCAN22; ZNF904; ZSCAN24
NM_001369720.1 - Homo sapiens (human) - NCBI - UCSC - RefEx(expression)
Homo sapiens paternally expressed 3 (PEG3), transcript variant 13, mRNA. (8698 bp)
gttttggtaataaattttatgtatgtattttccattacaaatataatacatactcatacaaaactttggaaattcagtaaagaaaattcacacatattcccaacacccaacaacaattaactgttaacatcttgatctgtgcactagtctgtgattattagggtgttagtgataagtatgcataaatgtcaaagatgggaagaaagatgaaaaacaagaaatagttgtgtggttgttgtgggattatggttattttgtttcggtttccttgaaaggtcatcattctagtgttttggtagtccacctttactacatatatttccattatatatgaaatgtgttcattatagaaactttgaagttacagaaatgtagaagagaaactcacccatgttttcaccatccaaagagtgtggttaacatcttgatatattttcttcatcttgtttctgtgcacaggtttttggtttgttaatatggttgtggtcattctatctgtaatagtgtcaacaataaaaataaagttaaaaataaa
position 8261 8291 8381 8419 8433 8447 8461 8540 8551 8612 8642
Synonym: PW1; ZKSCAN22; ZNF904; ZSCAN24
NM_001369724.1 - Homo sapiens (human) - NCBI - UCSC - RefEx(expression)
Homo sapiens paternally expressed 3 (PEG3), transcript variant 1, mRNA. (8754 bp)
gttttggtaataaattttatgtatgtattttccattacaaatataatacatactcatacaaaactttggaaattcagtaaagaaaattcacacatattcccaacacccaacaacaattaactgttaacatcttgatctgtgcactagtctgtgattattagggtgttagtgataagtatgcataaatgtcaaagatgggaagaaagatgaaaaacaagaaatagttgtgtggttgttgtgggattatggttattttgtttcggtttccttgaaaggtcatcattctagtgttttggtagtccacctttactacatatatttccattatatatgaaatgtgttcattatagaaactttgaagttacagaaatgtagaagagaaactcacccatgttttcaccatccaaagagtgtggttaacatcttgatatattttcttcatcttgtttctgtgcacaggtttttggtttgttaatatggttgtggtcattctatctgtaatagtgtcaacaataaaaataaagttaaaaataaa
position 8317 8347 8437 8475 8489 8503 8517 8596 8607 8668 8698
Synonym: PW1; ZKSCAN22; ZNF904; ZSCAN24
NM_006210.3 - Homo sapiens (human) - NCBI - UCSC - RefEx(expression)
Homo sapiens paternally expressed 3 (PEG3), transcript variant 7, mRNA. (8760 bp)
gttttggtaataaattttatgtatgtattttccattacaaatataatacatactcatacaaaactttggaaattcagtaaagaaaattcacacatattcccaacacccaacaacaattaactgttaacatcttgatctgtgcactagtctgtgattattagggtgttagtgataagtatgcataaatgtcaaagatgggaagaaagatgaaaaacaagaaatagttgtgtggttgttgtgggattatggttattttgtttcggtttccttgaaaggtcatcattctagtgttttggtagtccacctttactacatatatttccattatatatgaaatgtgttcattatagaaactttgaagttacagaaatgtagaagagaaactcacccatgttttcaccatccaaagagtgtggttaacatcttgatatattttcttcatcttgtttctgtgcacaggtttttggtttgttaatatggttgtggtcattctatctgtaatagtgtcaacaataaaaataaagttaaaaataaa
position 8323 8353 8443 8481 8495 8509 8523 8602 8613 8674 8704
Synonym: PW1; ZKSCAN22; ZNF904; ZSCAN24
NM_001369718.1 - Homo sapiens (human) - NCBI - UCSC - RefEx(expression)

Data Export:

Maximum 10000 results can be retrieved as Tab-delimited text or JSON format.

Debug Info:

Redirect URI : http://ggrna.dbcls.jp/hs/209242_at
lang : en | div : | spe : hs | query_string : 209242_at | format : html | download :

0.000 | 0.000 | search_start;
0.088 | 0.088 | count_done; http://172.18.8.71:7700/v1/refsub/query?q=(nt:TGTTTCGGTTTCCTTGAAAGGTCAT)?source=Homo sapiens (human)?to=0&format=json
0.101 | 0.013 | count_done; http://172.18.8.71:7700/v1/refsub/query?q=(nt:TGAAAGGTCATCATTCTAGTGTTTT)?source=Homo sapiens (human)?to=0&format=json
0.112 | 0.010 | count_done; http://172.18.8.71:7700/v1/refsub/query?q=(nt:TCTGTGCACAGGTTTTTGGTTTGTT)?source=Homo sapiens (human)?to=0&format=json
0.121 | 0.010 | count_done; http://172.18.8.71:7700/v1/refsub/query?q=(nt:TCTAGTGTTTTGGTAGTCCACCTTT)?source=Homo sapiens (human)?to=0&format=json
0.132 | 0.010 | count_done; http://172.18.8.71:7700/v1/refsub/query?q=(nt:TCCCAACACCCAACAACAATTAACT)?source=Homo sapiens (human)?to=0&format=json
0.142 | 0.010 | count_done; http://172.18.8.71:7700/v1/refsub/query?q=(nt:GGTTGTGGTCATTCTATCTGTAATA)?source=Homo sapiens (human)?to=0&format=json
0.152 | 0.011 | count_done; http://172.18.8.71:7700/v1/refsub/query?q=(nt:GAAATAGTTGTGTGGTTGTTGTGGG)?source=Homo sapiens (human)?to=0&format=json
0.162 | 0.010 | count_done; http://172.18.8.71:7700/v1/refsub/query?q=(nt:CCCATGTTTTCACCATCCAAAGAGT)?source=Homo sapiens (human)?to=0&format=json
0.174 | 0.011 | count_done; http://172.18.8.71:7700/v1/refsub/query?q=(nt:CATCTTGATCTGTGCACTAGTCTGT)?source=Homo sapiens (human)?to=0&format=json
0.183 | 0.010 | count_done; http://172.18.8.71:7700/v1/refsub/query?q=(nt:AGTCCACCTTTACTACATATATTTC)?source=Homo sapiens (human)?to=0&format=json
0.194 | 0.011 | count_done; http://172.18.8.71:7700/v1/refsub/query?q=(nt:AGAGAAACTCACCCATGTTTTCACC)?source=Homo sapiens (human)?to=0&format=json
1.469 | 1.275 | search_done; http://172.18.8.71:7700/v1/refsub/query?q=(nt:TGTTTCGGTTTCCTTGAAAGGTCAT)%26(nt:TGAAAGGTCATCATTCTAGTGTTTT)%26(nt:TCTGTGCACAGGTTTTTGGTTTGTT)%26(nt:TCTAGTGTTTTGGTAGTCCACCTTT)%26(nt:TCCCAACACCCAACAACAATTAACT)%26(nt:GGTTGTGGTCATTCTATCTGTAATA)%26(nt:GAAATAGTTGTGTGGTTGTTGTGGG)%26(nt:CCCATGTTTTCACCATCCAAAGAGT)%26(nt:CATCTTGATCTGTGCACTAGTCTGT)%26(nt:AGTCCACCTTTACTACATATATTTC)%26(nt:AGAGAAACTCACCCATGTTTTCACC)?source=Homo sapiens (human)?to=49?from=0?snippet=full_search?drilldown=source?get=accession,version,gi,length,symbol,synonym,geneid,division,source,definition&format=json
1.485 | 0.017 | cgi_end;

GGRNA ver.2 by @meso_cacase at DBCLS
This page is licensed under a Creative Commons Attribution 4.0 International License (CC BY 4.0).

If you use GGRNA in your work, please cite:
Naito Y, Bono H. (2012)
GGRNA: an ultrafast, transcript-oriented search engine for genes and transcripts.
Nucleic Acids Res., 40, W592-W596. [Full Text]