GGRNA ver.2 Help | Advanced search | Japanese    Previous release (v1)

2021-10-29 02:07:03, GGRNA : RefSeq release 207 (Jul, 2021)

Summary:

Results:

Matches are highlighted with green background. Overlapping matches are dark colored.

Homo sapiens peroxisome proliferator activated receptor gamma (PPARG), transcript variant 9, mRNA. (1646 bp)
caaagaggtggccatccgcatctttcagggctgccagtttcgctccgtggaggctgtgcaggagatcacagagtatgccaaaagcattcctggttttgtaaatcttgacttgaacgaccaagtaactctcctcaaatatggagtccacgagatcatttacacaatgctggcctccttgatgaataaagatggggttctcatatccgagggccaaggcttcatgacaagggagtttctaaagagcctgcgaaagccttttggtgactttatggagcccaagtttgagtttgctgtgaagttcaatgcactggaattagatgacagcgacttggcaatatttattgctgtcattattctcagtggagaccgcccaggtttgctgaatgtgaagcccattgaagacattcaagacaacctgctacaagccctggagctccagctgaagctgaaccaccctgagtcctcacagctgtttgccaagctgctccagaaaatgacagacctcagacagattgtcacggaacacgtgcagctactgcaggtgatcaagaagacggagacagacatgagtcttcacccgctcctgcaggagatctacaa...
position 853 868 974 996 1021 1035 1075 1105 1239 1351 1392
Synonym: CIMT1; GLM1; NR1C3; PPARG1; PPARG2; PPARG5; PPARgamma
NM_001354669.2 - Homo sapiens (human) - NCBI - UCSC - RefEx(expression)
Homo sapiens peroxisome proliferator activated receptor gamma (PPARG), transcript variant 7, mRNA. (1710 bp)
caaagaggtggccatccgcatctttcagggctgccagtttcgctccgtggaggctgtgcaggagatcacagagtatgccaaaagcattcctggttttgtaaatcttgacttgaacgaccaagtaactctcctcaaatatggagtccacgagatcatttacacaatgctggcctccttgatgaataaagatggggttctcatatccgagggccaaggcttcatgacaagggagtttctaaagagcctgcgaaagccttttggtgactttatggagcccaagtttgagtttgctgtgaagttcaatgcactggaattagatgacagcgacttggcaatatttattgctgtcattattctcagtggagaccgcccaggtttgctgaatgtgaagcccattgaagacattcaagacaacctgctacaagccctggagctccagctgaagctgaaccaccctgagtcctcacagctgtttgccaagctgctccagaaaatgacagacctcagacagattgtcacggaacacgtgcagctactgcaggtgatcaagaagacggagacagacatgagtcttcacccgctcctgcaggagatctacaa...
position 917 932 1038 1060 1085 1099 1139 1169 1303 1415 1456
Synonym: CIMT1; GLM1; NR1C3; PPARG1; PPARG2; PPARG5; PPARgamma
NM_001354667.3 - Homo sapiens (human) - NCBI - UCSC - RefEx(expression)
Homo sapiens peroxisome proliferator activated receptor gamma (PPARG), transcript variant 14, mRNA. (1771 bp)
caaagaggtggccatccgcatctttcagggctgccagtttcgctccgtggaggctgtgcaggagatcacagagtatgccaaaagcattcctggttttgtaaatcttgacttgaacgaccaagtaactctcctcaaatatggagtccacgagatcatttacacaatgctggcctccttgatgaataaagatggggttctcatatccgagggccaaggcttcatgacaagggagtttctaaagagcctgcgaaagccttttggtgactttatggagcccaagtttgagtttgctgtgaagttcaatgcactggaattagatgacagcgacttggcaatatttattgctgtcattattctcagtggagaccgcccaggtttgctgaatgtgaagcccattgaagacattcaagacaacctgctacaagccctggagctccagctgaagctgaaccaccctgagtcctcacagctgtttgccaagctgctccagaaaatgacagacctcagacagattgtcacggaacacgtgcagctactgcaggtgatcaagaagacggagacagacatgagtcttcacccgctcctgcaggagatctacaa...
position 978 993 1099 1121 1146 1160 1200 1230 1364 1476 1517
Synonym: CIMT1; GLM1; NR1C3; PPARG1; PPARG2; PPARG5; PPARgamma
NM_001374264.2 - Homo sapiens (human) - NCBI - UCSC - RefEx(expression)
Homo sapiens peroxisome proliferator activated receptor gamma (PPARG), transcript variant 3, mRNA. (1774 bp)
caaagaggtggccatccgcatctttcagggctgccagtttcgctccgtggaggctgtgcaggagatcacagagtatgccaaaagcattcctggttttgtaaatcttgacttgaacgaccaagtaactctcctcaaatatggagtccacgagatcatttacacaatgctggcctccttgatgaataaagatggggttctcatatccgagggccaaggcttcatgacaagggagtttctaaagagcctgcgaaagccttttggtgactttatggagcccaagtttgagtttgctgtgaagttcaatgcactggaattagatgacagcgacttggcaatatttattgctgtcattattctcagtggagaccgcccaggtttgctgaatgtgaagcccattgaagacattcaagacaacctgctacaagccctggagctccagctgaagctgaaccaccctgagtcctcacagctgtttgccaagctgctccagaaaatgacagacctcagacagattgtcacggaacacgtgcagctactgcaggtgatcaagaagacggagacagacatgagtcttcacccgctcctgcaggagatctacaa...
position 981 996 1102 1124 1149 1163 1203 1233 1367 1479 1520
Synonym: CIMT1; GLM1; NR1C3; PPARG1; PPARG2; PPARG5; PPARgamma
NM_138711.6 - Homo sapiens (human) - NCBI - UCSC - RefEx(expression)
Homo sapiens peroxisome proliferator activated receptor gamma (PPARG), transcript variant 4, mRNA. (1782 bp)
caaagaggtggccatccgcatctttcagggctgccagtttcgctccgtggaggctgtgcaggagatcacagagtatgccaaaagcattcctggttttgtaaatcttgacttgaacgaccaagtaactctcctcaaatatggagtccacgagatcatttacacaatgctggcctccttgatgaataaagatggggttctcatatccgagggccaaggcttcatgacaagggagtttctaaagagcctgcgaaagccttttggtgactttatggagcccaagtttgagtttgctgtgaagttcaatgcactggaattagatgacagcgacttggcaatatttattgctgtcattattctcagtggagaccgcccaggtttgctgaatgtgaagcccattgaagacattcaagacaacctgctacaagccctggagctccagctgaagctgaaccaccctgagtcctcacagctgtttgccaagctgctccagaaaatgacagacctcagacagattgtcacggaacacgtgcagctactgcaggtgatcaagaagacggagacagacatgagtcttcacccgctcctgcaggagatctacaa...
position 989 1004 1110 1132 1157 1171 1211 1241 1375 1487 1528
Synonym: CIMT1; GLM1; NR1C3; PPARG1; PPARG2; PPARG5; PPARgamma
NM_005037.7 - Homo sapiens (human) - NCBI - UCSC - RefEx(expression)
Homo sapiens peroxisome proliferator activated receptor gamma (PPARG), transcript variant 13, mRNA. (1792 bp)
caaagaggtggccatccgcatctttcagggctgccagtttcgctccgtggaggctgtgcaggagatcacagagtatgccaaaagcattcctggttttgtaaatcttgacttgaacgaccaagtaactctcctcaaatatggagtccacgagatcatttacacaatgctggcctccttgatgaataaagatggggttctcatatccgagggccaaggcttcatgacaagggagtttctaaagagcctgcgaaagccttttggtgactttatggagcccaagtttgagtttgctgtgaagttcaatgcactggaattagatgacagcgacttggcaatatttattgctgtcattattctcagtggagaccgcccaggtttgctgaatgtgaagcccattgaagacattcaagacaacctgctacaagccctggagctccagctgaagctgaaccaccctgagtcctcacagctgtttgccaagctgctccagaaaatgacagacctcagacagattgtcacggaacacgtgcagctactgcaggtgatcaagaagacggagacagacatgagtcttcacccgctcctgcaggagatctacaa...
position 999 1014 1120 1142 1167 1181 1221 1251 1385 1497 1538
Synonym: CIMT1; GLM1; NR1C3; PPARG1; PPARG2; PPARG5; PPARgamma
NM_001374263.2 - Homo sapiens (human) - NCBI - UCSC - RefEx(expression)
Homo sapiens peroxisome proliferator activated receptor gamma (PPARG), transcript variant 1, mRNA. (1856 bp)
caaagaggtggccatccgcatctttcagggctgccagtttcgctccgtggaggctgtgcaggagatcacagagtatgccaaaagcattcctggttttgtaaatcttgacttgaacgaccaagtaactctcctcaaatatggagtccacgagatcatttacacaatgctggcctccttgatgaataaagatggggttctcatatccgagggccaaggcttcatgacaagggagtttctaaagagcctgcgaaagccttttggtgactttatggagcccaagtttgagtttgctgtgaagttcaatgcactggaattagatgacagcgacttggcaatatttattgctgtcattattctcagtggagaccgcccaggtttgctgaatgtgaagcccattgaagacattcaagacaacctgctacaagccctggagctccagctgaagctgaaccaccctgagtcctcacagctgtttgccaagctgctccagaaaatgacagacctcagacagattgtcacggaacacgtgcagctactgcaggtgatcaagaagacggagacagacatgagtcttcacccgctcctgcaggagatctacaa...
position 1063 1078 1184 1206 1231 1245 1285 1315 1449 1561 1602
Synonym: CIMT1; GLM1; NR1C3; PPARG1; PPARG2; PPARG5; PPARgamma
NM_138712.5 - Homo sapiens (human) - NCBI - UCSC - RefEx(expression)
Homo sapiens peroxisome proliferator activated receptor gamma (PPARG), transcript variant 2, mRNA. (1893 bp)
caaagaggtggccatccgcatctttcagggctgccagtttcgctccgtggaggctgtgcaggagatcacagagtatgccaaaagcattcctggttttgtaaatcttgacttgaacgaccaagtaactctcctcaaatatggagtccacgagatcatttacacaatgctggcctccttgatgaataaagatggggttctcatatccgagggccaaggcttcatgacaagggagtttctaaagagcctgcgaaagccttttggtgactttatggagcccaagtttgagtttgctgtgaagttcaatgcactggaattagatgacagcgacttggcaatatttattgctgtcattattctcagtggagaccgcccaggtttgctgaatgtgaagcccattgaagacattcaagacaacctgctacaagccctggagctccagctgaagctgaaccaccctgagtcctcacagctgtttgccaagctgctccagaaaatgacagacctcagacagattgtcacggaacacgtgcagctactgcaggtgatcaagaagacggagacagacatgagtcttcacccgctcctgcaggagatctacaa...
position 1100 1115 1221 1243 1268 1282 1322 1352 1486 1598 1639
Synonym: CIMT1; GLM1; NR1C3; PPARG1; PPARG2; PPARG5; PPARgamma
NM_015869.5 - Homo sapiens (human) - NCBI - UCSC - RefEx(expression)
Homo sapiens peroxisome proliferator activated receptor gamma (PPARG), transcript variant 6, mRNA. (2017 bp)
caaagaggtggccatccgcatctttcagggctgccagtttcgctccgtggaggctgtgcaggagatcacagagtatgccaaaagcattcctggttttgtaaatcttgacttgaacgaccaagtaactctcctcaaatatggagtccacgagatcatttacacaatgctggcctccttgatgaataaagatggggttctcatatccgagggccaaggcttcatgacaagggagtttctaaagagcctgcgaaagccttttggtgactttatggagcccaagtttgagtttgctgtgaagttcaatgcactggaattagatgacagcgacttggcaatatttattgctgtcattattctcagtggagaccgcccaggtttgctgaatgtgaagcccattgaagacattcaagacaacctgctacaagccctggagctccagctgaagctgaaccaccctgagtcctcacagctgtttgccaagctgctccagaaaatgacagacctcagacagattgtcacggaacacgtgcagctactgcaggtgatcaagaagacggagacagacatgagtcttcacccgctcctgcaggagatctacaa...
position 1224 1239 1345 1367 1392 1406 1446 1476 1610 1722 1763
Synonym: CIMT1; GLM1; NR1C3; PPARG1; PPARG2; PPARG5; PPARgamma
NM_001354666.3 - Homo sapiens (human) - NCBI - UCSC - RefEx(expression)

Data Export:

Maximum 10000 results can be retrieved as Tab-delimited text or JSON format.

Debug Info:

Redirect URI : http://ggrna.dbcls.jp/hs/208510_s_at
lang : en | div : | spe : hs | query_string : 208510_s_at | format : html | download :

0.000 | 0.000 | search_start;
0.257 | 0.257 | count_done; http://172.18.8.71:7700/v1/refseq/query?q=(nt:TTCAAGACAACCTGCTACAAGCCCT)?source=Homo sapiens (human)?to=0&format=json
0.264 | 0.007 | count_done; http://172.18.8.71:7700/v1/refseq/query?q=(nt:TATCCGAGGGCCAAGGCTTCATGAC)?source=Homo sapiens (human)?to=0&format=json
0.271 | 0.007 | count_done; http://172.18.8.71:7700/v1/refseq/query?q=(nt:GGAGTCCACGAGATCATTTACACAA)?source=Homo sapiens (human)?to=0&format=json
0.280 | 0.009 | count_done; http://172.18.8.71:7700/v1/refseq/query?q=(nt:GGAGCCCAAGTTTGAGTTTGCTGTG)?source=Homo sapiens (human)?to=0&format=json
0.288 | 0.008 | count_done; http://172.18.8.71:7700/v1/refseq/query?q=(nt:GAGCCTGCGAAAGCCTTTTGGTGAC)?source=Homo sapiens (human)?to=0&format=json
0.300 | 0.012 | count_done; http://172.18.8.71:7700/v1/refseq/query?q=(nt:CCAGTTTCGCTCCGTGGAGGCTGTG)?source=Homo sapiens (human)?to=0&format=json
0.311 | 0.010 | count_done; http://172.18.8.71:7700/v1/refseq/query?q=(nt:CATCTTTCAGGGCTGCCAGTTTCGC)?source=Homo sapiens (human)?to=0&format=json
0.319 | 0.009 | count_done; http://172.18.8.71:7700/v1/refseq/query?q=(nt:CACGGAACACGTGCAGCTACTGCAG)?source=Homo sapiens (human)?to=0&format=json
0.327 | 0.007 | count_done; http://172.18.8.71:7700/v1/refseq/query?q=(nt:CAATGCTGGCCTCCTTGATGAATAA)?source=Homo sapiens (human)?to=0&format=json
0.335 | 0.008 | count_done; http://172.18.8.71:7700/v1/refseq/query?q=(nt:AGATGGGGTTCTCATATCCGAGGGC)?source=Homo sapiens (human)?to=0&format=json
0.342 | 0.007 | count_done; http://172.18.8.71:7700/v1/refseq/query?q=(nt:AGACAGACATGAGTCTTCACCCGCT)?source=Homo sapiens (human)?to=0&format=json
0.842 | 0.500 | search_done; http://172.18.8.71:7700/v1/refseq/query?q=(nt:TTCAAGACAACCTGCTACAAGCCCT)%26(nt:TATCCGAGGGCCAAGGCTTCATGAC)%26(nt:GGAGTCCACGAGATCATTTACACAA)%26(nt:GGAGCCCAAGTTTGAGTTTGCTGTG)%26(nt:GAGCCTGCGAAAGCCTTTTGGTGAC)%26(nt:CCAGTTTCGCTCCGTGGAGGCTGTG)%26(nt:CATCTTTCAGGGCTGCCAGTTTCGC)%26(nt:CACGGAACACGTGCAGCTACTGCAG)%26(nt:CAATGCTGGCCTCCTTGATGAATAA)%26(nt:AGATGGGGTTCTCATATCCGAGGGC)%26(nt:AGACAGACATGAGTCTTCACCCGCT)?source=Homo sapiens (human)?to=49?from=0?snippet=full_search?drilldown=source?get=accession,version,gi,length,symbol,synonym,geneid,division,source,definition&format=json
0.848 | 0.006 | cgi_end;

GGRNA ver.2 by @meso_cacase at DBCLS
This page is licensed under a Creative Commons Attribution 4.0 International License (CC BY 4.0).

If you use GGRNA in your work, please cite:
Naito Y, Bono H. (2012)
GGRNA: an ultrafast, transcript-oriented search engine for genes and transcripts.
Nucleic Acids Res., 40, W592-W596. [Full Text]