GGRNA ver.2 Help | Advanced search | Japanese    Previous release (v1)

2018-10-20 19:30:32, GGRNA : RefSeq release 90 (Sep, 2018)

Summary:

Results:

Matches are highlighted with green background. Overlapping matches are dark colored.

Homo sapiens pregnancy specific beta-1-glycoprotein 4 (PSG4), transcript variant 1, mRNA. (2195 bp)
agttcctccaattccattttctcccatggaatcacgaagagcaagacccactctgttccagaagccctataagctggaggtggacaactcgatgtaaatttcatgggaaaacccttgtacctgacatgtgagccactcagaactcaccaaaatgttcgacaccataacaacagctactcaaactgtaaaccaggataacaagttgatgacttcacactgtggacagtttttccaaagatgtcagaacaagactccccatcatgataaggctcccacccctcttaaccgtccttgctcatgcctgcctctttcacttggcaggataatgcagtcattagaatttcacatgtagtagcttctgagggtaacaacagagtgtcagatatgtcatctcaacctcaaacttttacgtaacatctcaggggaaatgtggctctctccatcttgcatacagggctcccaatagaaatgaacacagagatattgcctgtgtgtttgcagagaagatggtttctataaagagtaggaaagctgaaattatagtagagtctcctttaaatgcacattgtgtggatggctctcaccatttcctaagagata...
position 1541 1616 1637 1664 1706 1755 1804 1888 1925 1948 2049
Synonym: PSBG-4; PSBG-9; PSG9
NM_002780.4 - Homo sapiens (human) - NCBI - UCSC - RefEx(expression)
Homo sapiens pregnancy specific beta-1-glycoprotein 4 (PSG4), transcript variant 4, mRNA. (1829 bp)
agttcctccaattccattttctcccatggaatcacgaagagcaagacccactctgttccagaagccctataagctggaggtggacaactcgatgtaaatttcatgggaaaacccttgtacctgacatgtgagccactcagaactcaccaaaatgttcgacaccataacaacagctactcaaactgtaaaccaggataacaagttgatgacttcacactgtggacagtttttccaaagatgtcagaacaagactccccatcatgataaggctcccacccctcttaaccgtccttgctcatgcctgcctctttcacttggcaggataatgcagtcattagaatttcacatgtagtagcttctgagggtaacaacagagtgtcagatatgtcatctcaacctcaaacttttacgtaacatctcaggggaaatgtggctctctccatcttgcatacagggctcccaatagaaatgaacacagagatattgcctgtgtgtttgcagagaagatggtttctataaagagtaggaaagctgaaattatagtagagtctcctttaaatgcacattgtgtggatggctctcaccatttcctaagagata...
position 1175 1250 1271 1298 1340 1389 1438 1522 1559 1582 1683
Synonym: PSBG-4; PSBG-9; PSG9
NM_001316339.1 - Homo sapiens (human) - NCBI - UCSC - RefEx(expression)
Homo sapiens pregnancy specific beta-1-glycoprotein 4 (PSG4), transcript variant 3, mRNA. (1916 bp)
agttcctccaattccattttctcccatggaatcacgaagagcaagacccactctgttccagaagccctataagctggaggtggacaactcgatgtaaatttcatgggaaaacccttgtacctgacatgtgagccactcagaactcaccaaaatgttcgacaccataacaacagctactcaaactgtaaaccaggataacaagttgatgacttcacactgtggacagtttttccaaagatgtcagaacaagactccccatcatgataaggctcccacccctcttaaccgtccttgctcatgcctgcctctttcacttggcaggataatgcagtcattagaatttcacatgtagtagcttctgagggtaacaacagagtgtcagatatgtcatctcaacctcaaacttttacgtaacatctcaggggaaatgtggctctctccatcttgcatacagggctcccaatagaaatgaacacagagatattgcctgtgtgtttgcagagaagatggtttctataaagagtaggaaagctgaaattatagtagagtctcctttaaatgcacattgtgtggatggctctcaccatttcctaagagata...
position 1262 1337 1358 1385 1427 1476 1525 1609 1646 1669 1770
Synonym: PSBG-4; PSBG-9; PSG9
NM_001276495.1 - Homo sapiens (human) - NCBI - UCSC - RefEx(expression)
Homo sapiens pregnancy specific beta-1-glycoprotein 4 (PSG4), transcript variant 2, mRNA. (1916 bp)
agttcctccaattccattttctcccatggaatcacgaagagcaagacccactctgttccagaagccctataagctggaggtggacaactcgatgtaaatttcatgggaaaacccttgtacctgacatgtgagccactcagaactcaccaaaatgttcgacaccataacaacagctactcaaactgtaaaccaggataacaagttgatgacttcacactgtggacagtttttccaaagatgtcagaacaagactccccatcatgataaggctcccacccctcttaaccgtccttgctcatgcctgcctctttcacttggcaggataatgcagtcattagaatttcacatgtagtagcttctgagggtaacaacagagtgtcagatatgtcatctcaacctcaaacttttacgtaacatctcaggggaaatgtggctctctccatcttgcatacagggctcccaatagaaatgaacacagagatattgcctgtgtgtttgcagagaagatggtttctataaagagtaggaaagctgaaattatagtagagtctcctttaaatgcacattgtgtggatggctctcaccatttcctaagagata...
position 1262 1337 1358 1385 1427 1476 1525 1609 1646 1669 1770
Synonym: PSBG-4; PSBG-9; PSG9
NM_213633.2 - Homo sapiens (human) - NCBI - UCSC - RefEx(expression)

Data Export:

Maximum 10000 results can be retrieved as Tab-delimited text or JSON format.

Debug Info:

Redirect URI : http://ggrna.dbcls.jp/hs/208191_x_at
lang : en | div : | spe : hs | query_string : 208191_x_at | format : html | download :

0.000 | 0.000 | search_start;
0.328 | 0.328 | count_done; http://172.18.8.71:7700/v1/refsub/query?q=(nt:TCAGGGGAAATGTGGCTCTCTCCAT)?source=Homo sapiens (human)?to=0&format=json
0.733 | 0.405 | count_done; http://172.18.8.71:7700/v1/refsub/query?q=(nt:GTAGAGTCTCCTTTAAATGCACATT)?source=Homo sapiens (human)?to=0&format=json
0.741 | 0.008 | count_done; http://172.18.8.71:7700/v1/refsub/query?q=(nt:GATATGTCATCTCAACCTCAAACTT)?source=Homo sapiens (human)?to=0&format=json
0.748 | 0.007 | count_done; http://172.18.8.71:7700/v1/refsub/query?q=(nt:GACACCATAACAACAGCTACTCAAA)?source=Homo sapiens (human)?to=0&format=json
0.760 | 0.011 | count_done; http://172.18.8.71:7700/v1/refsub/query?q=(nt:CGAAGAGCAAGACCCACTCTGTTCC)?source=Homo sapiens (human)?to=0&format=json
0.766 | 0.007 | count_done; http://172.18.8.71:7700/v1/refsub/query?q=(nt:ATGCCTGCCTCTTTCACTTGGCAGG)?source=Homo sapiens (human)?to=0&format=json
0.777 | 0.011 | count_done; http://172.18.8.71:7700/v1/refsub/query?q=(nt:ATCTTGCATACAGGGCTCCCAATAG)?source=Homo sapiens (human)?to=0&format=json
0.785 | 0.008 | count_done; http://172.18.8.71:7700/v1/refsub/query?q=(nt:AGCCACTCAGAACTCACCAAAATGT)?source=Homo sapiens (human)?to=0&format=json
0.793 | 0.008 | count_done; http://172.18.8.71:7700/v1/refsub/query?q=(nt:AGACTCCCCATCATGATAAGGCTCC)?source=Homo sapiens (human)?to=0&format=json
0.803 | 0.010 | count_done; http://172.18.8.71:7700/v1/refsub/query?q=(nt:AAGTTGATGACTTCACACTGTGGAC)?source=Homo sapiens (human)?to=0&format=json
1.459 | 0.656 | count_done; http://172.18.8.71:7700/v1/refsub/query?q=(nt:AACCCTTGTACCTGACATGTGAGCC)?source=Homo sapiens (human)?to=0&format=json
1.530 | 0.071 | search_done; http://172.18.8.71:7700/v1/refsub/query?q=(nt:TCAGGGGAAATGTGGCTCTCTCCAT)%26(nt:GTAGAGTCTCCTTTAAATGCACATT)%26(nt:GATATGTCATCTCAACCTCAAACTT)%26(nt:GACACCATAACAACAGCTACTCAAA)%26(nt:CGAAGAGCAAGACCCACTCTGTTCC)%26(nt:ATGCCTGCCTCTTTCACTTGGCAGG)%26(nt:ATCTTGCATACAGGGCTCCCAATAG)%26(nt:AGCCACTCAGAACTCACCAAAATGT)%26(nt:AGACTCCCCATCATGATAAGGCTCC)%26(nt:AAGTTGATGACTTCACACTGTGGAC)%26(nt:AACCCTTGTACCTGACATGTGAGCC)?source=Homo sapiens (human)?to=49?from=0?snippet=full_search?drilldown=source?get=accession,version,gi,length,symbol,synonym,geneid,division,source,definition&format=json
1.533 | 0.003 | cgi_end;

GGRNA ver.2 by @meso_cacase at DBCLS
This page is licensed under a Creative Commons Attribution 4.0 International License (CC BY 4.0).

If you use GGRNA in your work, please cite:
Naito Y, Bono H. (2012)
GGRNA: an ultrafast, transcript-oriented search engine for genes and transcripts.
Nucleic Acids Res., 40, W592-W596. [Full Text]