GGRNA ver.2 Help | Advanced search | Japanese    Previous release (v1)

2021-01-17 00:23:35, GGRNA : RefSeq release 203 (Nov, 2020)

Summary:

Results:

Matches are highlighted with green background. Overlapping matches are dark colored.

Homo sapiens testis specific protein Y-linked 1 (TSPY1), transcript variant 3, mRNA. (900 bp)
ttgttctttcggagtaacccctacttccagaataaagtgattaccaaggaatatctggtgaacatcacagaatacagggcttctcattccactccaattgagtggtatccggattatgaagtggaggcctatcgccgcagacaccacaacagcagccttaacttcttcaactggttctctgaccacaacttcgcaggatctaacaagattgctgagatcctatgtaaggacctgtggcgcaatcccctgcaatactacaagaggatgaagccacctgaagagggaacagagacgtcaggggactcccagttgttgagttgaatatgatggagcatcagattttacctaatacagcagaactcctaaaaagttacagccatatgcaggacggcagtactcagcatggtcttatgcacaggaactaaaggaaaaagagatcgagtcacaaaaattcaggaagagggggtaaatgtggattgtatggaatgaaaaataaacattctcaagga
position 566 573 594 613 674 689 720 758 773 780 793
Synonym: CT78; DYS14; pJA923; TSPY
NM_001320964.2 - Homo sapiens (human) - NCBI - UCSC - RefEx(expression)
PREDICTED: Homo sapiens testis specific protein Y-linked 8 (TSPY8), transcript variant X2, mRNA. (1129 bp)
gatcatgttgttctttcggagtaacccctacttccagaataaagtgattaccaaggaatatctggtgaacatcacagggcttctcattccactccaattgagtggtatctggattatgaagtggaggcctatcgccgcagacaccacaacagcagccttaacttcttcaactggttctctgaccacaacttcgcaggatctaacaagattgctgagatcctatgtaaggacctgtggcgcaatcccctgcaatactacaagaggatgaagccacctgaagagggaacagagacgtcaggggactcccagttgttgagttgaatatgatggagcatcagattttacctaatacagcagaactcctaaaaagttacagccatatgcaggacggcagtactcagcatggtcttatgcacaggaactaaaggaaaaagagatcgagtcacaaaaattcaggaagagggggtaaatgtggattgtatggaatgaaaaataaacattctcaaggatgtgtga
position 788 795 816 835 896 911 942 980 995 1002 1015
XM_011544005.2 - Homo sapiens (human) - NCBI - UCSC - RefEx(expression)
PREDICTED: Homo sapiens testis specific protein Y-linked 10 (TSPY10), transcript variant X1, mRNA. (1129 bp)
gatcatgttgttctttcggagtaacccctacttccagaataaagtgattaccaaggaatatctggtgaacatcacagggcttctcattccactccaattgagtggtatccggattatgaagtggaggcctatcgccgcagacaccacaacagcagccttaacttcttcaactggttctctgaccacaacttcgcaggatctaacaagattgctgagatcctatgtaaggacctgtggcgcaatcccctgcaatactacaagaggatgaagccacctgaagagggaacagagacgtcaggggactcccagttgttgagttgaatatgatggagcatcagattttacctaatacagcagaactcctaaaaagttacagccatatgcaggacggcagtactcagcatggtcttatgcacaggaactaaaggaaaaacagatcgagtcacaaaaattcaggaagagggggtaaatgtggattgtatggaatgaaaaataaacattctcaagga
position 795 802 823 842 903 918 949 987 1002 1009 1022
Synonym: CT78; TSPY; TSPY1; TSPY3
XM_017030025.1 - Homo sapiens (human) - NCBI - UCSC - RefEx(expression)
PREDICTED: Homo sapiens testis specific protein Y-linked 3 (TSPY3), transcript variant X2, mRNA. (1136 bp)
gatcatgttgttctttcggagtaacccctacttccagaataaagtgattaccaaggaatatctggtgaacatcacagggcttctcattccactccaattgagtggtatccggattatgaagtggaggcgtatcgccgcagacaccacaacagcagccttaacttcttcaactggttctctgaccacaacttcgcaggatctaacaagattgctgagatcctatgtaaggacctgtggcgcaatcccctgcaatactacaagaggatgaagccacctgaagagggaacagagacgtcaggggactcccagttgttgagttgaatatgatggagcatcagattttacctaatacagcagaactcctaaaaagttacagccatatgcaggacggcagtactcagcatggtcttatgcacaggaactaaaggaaaaagagatcgagtcacaaaaattcaggaagagggggtaaatgtggattgtatggaatgaaaaataaacattctcaaggatgtgtga
position 795 802 823 842 903 918 949 987 1002 1009 1022
Synonym: CT78; TSPY; TSPY1; TSPY10
XM_011544004.2 - Homo sapiens (human) - NCBI - UCSC - RefEx(expression)
PREDICTED: Homo sapiens testis specific protein Y-linked 1 (TSPY1), transcript variant X1, mRNA. (1136 bp)
gatcatgttgttctttcggagtaacccctacttccagaataaagtgattaccaaggaatatctggtgaacatcacagggcttctcattccactccaattgagtggtatccggattatgaagtggaggcctatcgccgcagacaccacaacagcagccttaacttcttcaactggttctctgaccacaacttcgcaggatctaacaagattgctgagatcctatgtaaggacctgtggcgcaatcccctgcaatactacaagaggatgaagccacctgaagagggaacagagacgtcaggggactcccagttgttgagttgaatatgatggagcatcagattttacctaatacagcagaactcctaaaaagttacagccatatgcaggacggcagtactcagcatggtcttatgcacaggaactaaaggaaaaagagatcgagtcacaaaaattcaggaagagggggtaaatgtggattgtatggaatgaaaaataaacattctcaaggatgtgtga
position 795 802 823 842 903 918 949 987 1002 1009 1022
Synonym: CT78; DYS14; pJA923; TSPY
XM_017030064.1 - Homo sapiens (human) - NCBI - UCSC - RefEx(expression)
PREDICTED: Homo sapiens testis specific protein Y-linked 4 (TSPY4), transcript variant X2, mRNA. (1154 bp)
gatcatgttgttctttcggagtaacccctacttccagaataaagtgattaccaaggaatatctggtgaacatcacagggcttctcattccactccaattgagtggtatccggattatgaagtggaggcctatcgccgcagacaccacaacagcagccttaacttcttcaactggttctctgaccacaacttcgcaggatctaacaagattgctgagatcctatgtaaggacctgtggcgcaatcccctgcaatactacaagaggatgaagccacctgaagagggaacagagacgtcaggggactcccagttgttgagttgaatatgatggagcatcagattttacctaatacagcagaactcctaaaaagttacagccatatgcaggacggcagtactcagcatggtcttatgcacaggaactaaaggaaaaagagatcgagtcacaaaaattcaggaagagggggtaaatgtggattgtatggaatgaaaaataaacattctcaaggatgtgtga
position 813 820 841 860 921 936 967 1005 1020 1027 1040
Synonym: TSPY10; TSPY8
XM_017030065.1 - Homo sapiens (human) - NCBI - UCSC - RefEx(expression)
Homo sapiens testis specific protein Y-linked 4 (TSPY4), mRNA. (1156 bp)
ttgttctttcggagtaacccctacttccagaataaagtgattaccaaggaatatctggtgaacatcacagaatacagggcttctcattccactccaattgagtggtatccggattatgaagtggaggcctatcgccgcagacaccacaacagcagccttaacttcttcaactggttctctgaccacaacttcgcaggatctaacaagattgctgagatcctatgtaaggacctgtggcgcaatcccctgcaatactacaagaggatgaagccacctgaagagggaacagagacgtcaggggactcccagttgttgagttgaatatgatggagcatcagattttacctaatacagcagaactcctaaaaagttacagccatatgcaggacggcagtactcagcatggtcttatgcacaggaactaaaggaaaaagagatcgagtcacaaaaattcaggaagagggggtaaatgtggattgtatggaatgaaaaataaacattctcaaggaaaaaaaaaaaaaaaaaaaaaaaa
position 799 806 827 846 907 922 953 991 1006 1013 1026
Synonym: TSPY10; TSPY8
NM_001164471.1 - Homo sapiens (human) - NCBI - UCSC - RefEx(expression)
Homo sapiens testis specific protein Y-linked 10 (TSPY10), transcript variant 1, mRNA. (1161 bp)
ttgttctttcggagtaacccctacttccagaataaagtgattaccaaggaatatctggtgaacatcacagaatacagggcttctcattccactccaattgagtggtatccggattatgaagtggaggcctatcgccgcagacaccacaacagcagccttaacttcttcaactggttctctgaccacaacttcgcaggatctaacaagattgctgagatcctatgtaaggacctgtggcgcaatcccctgcaatactacaagaggatgaagccacctgaagagggaacagagacgtcaggggactcccagttgttgagttgaatatgatggagcatcagattttacctaatacagcagaactcctaaaaagttacagccatatgcaggacggcagtactcagcatggtcttatgcacaggaactaaaggaaaaacagatcgagtcacaaaaattcaggaagagggggtaaatgtggattgtatggaatgaaaaataaacattctcaagga
position 827 834 855 874 935 950 981 1019 1034 1041 1054
Synonym: CT78; TSPY; TSPY1; TSPY3
NM_001282469.3 - Homo sapiens (human) - NCBI - UCSC - RefEx(expression)
Homo sapiens testis specific protein Y-linked 1 (TSPY1), transcript variant 1, mRNA. (1161 bp)
ttgttctttcggagtaacccctacttccagaataaagtgattaccaaggaatatctggtgaacatcacagaatacagggcttctcattccactccaattgagtggtatccggattatgaagtggaggcctatcgccgcagacaccacaacagcagccttaacttcttcaactggttctctgaccacaacttcgcaggatctaacaagattgctgagatcctatgtaaggacctgtggcgcaatcccctgcaatactacaagaggatgaagccacctgaagagggaacagagacgtcaggggactcccagttgttgagttgaatatgatggagcatcagattttacctaatacagcagaactcctaaaaagttacagccatatgcaggacggcagtactcagcatggtcttatgcacaggaactaaaggaaaaagagatcgagtcacaaaaattcaggaagagggggtaaatgtggattgtatggaatgaaaaataaacattctcaagga
position 827 834 855 874 935 950 981 1019 1034 1041 1054
Synonym: CT78; DYS14; pJA923; TSPY
NM_003308.4 - Homo sapiens (human) - NCBI - UCSC - RefEx(expression)
Homo sapiens testis specific protein Y-linked 3 (TSPY3), mRNA. (1161 bp)
ttgttctttcggagtaacccctacttccagaataaagtgattaccaaggaatatctggtgaacatcacagaatacagggcttctcattccactccaattgagtggtatccggattatgaagtggaggcgtatcgccgcagacaccacaacagcagccttaacttcttcaactggttctctgaccacaacttcgcaggatctaacaagattgctgagatcctatgtaaggacctgtggcgcaatcccctgcaatactacaagaggatgaagccacctgaagagggaacagagacgtcaggggactcccagttgttgagttgaatatgatggagcatcagattttacctaatacagcagaactcctaaaaagttacagccatatgcaggacggcagtactcagcatggtcttatgcacaggaactaaaggaaaaagagatcgagtcacaaaaattcaggaagagggggtaaatgtggattgtatggaatgaaaaataaacattctcaagga
position 827 834 855 874 935 950 981 1019 1034 1041 1054
Synonym: CT78; TSPY; TSPY1; TSPY10
NM_001077697.2 - Homo sapiens (human) - NCBI - UCSC - RefEx(expression)
Homo sapiens testis specific protein Y-linked 8 (TSPY8), mRNA. (1161 bp)
ttgttctttcggagtaacccctacttccagaataaagtgattaccaaggaatatctggtgaacatcacagaatacagggcttctcattccactccaattgagtggtatctggattatgaagtggaggcctatcgccgcagacaccacaacagcagccttaacttcttcaactggttctctgaccacaacttcgcaggatctaacaagattgctgagatcctatgtaaggacctgtggcgcaatcccctgcaatactacaagaggatgaagccacctgaagagggaacagagacgtcaggggactcccagttgttgagttgaatatgatggagcatcagattttacctaatacagcagaactcctaaaaagttacagccatatgcaggacggcagtactcagcatggtcttatgcacaggaactaaaggaaaaagagatcgagtcacaaaaattcaggaagagggggtaaatgtggattgtatggaatgaaaaataaacattctcaagga
position 827 834 855 874 935 950 981 1019 1034 1041 1054
NM_001243721.2 - Homo sapiens (human) - NCBI - UCSC - RefEx(expression)

Data Export:

Maximum 10000 results can be retrieved as Tab-delimited text or JSON format.

Debug Info:

Redirect URI : http://ggrna.dbcls.jp/hs/207918_s_at
lang : en | div : | spe : hs | query_string : 207918_s_at | format : html | download :

0.000 | 0.000 | search_start;
0.091 | 0.091 | count_done; http://172.18.8.71:7700/v1/refseq/query?q=(nt:TTCTCTGACCACAACTTCGCAGGAT)?source=Homo sapiens (human)?to=0&format=json
0.101 | 0.010 | count_done; http://172.18.8.71:7700/v1/refseq/query?q=(nt:TGCAGGACGGCAGTACTCAGCATGG)?source=Homo sapiens (human)?to=0&format=json
0.115 | 0.014 | count_done; http://172.18.8.71:7700/v1/refseq/query?q=(nt:GGGGACTCCCAGTTGTTGAGTTGAA)?source=Homo sapiens (human)?to=0&format=json
0.126 | 0.011 | count_done; http://172.18.8.71:7700/v1/refseq/query?q=(nt:GGAGCATCAGATTTTACCTAATACA)?source=Homo sapiens (human)?to=0&format=json
0.136 | 0.010 | count_done; http://172.18.8.71:7700/v1/refseq/query?q=(nt:GGAACAGAGACGTCAGGGGACTCCC)?source=Homo sapiens (human)?to=0&format=json
0.146 | 0.010 | count_done; http://172.18.8.71:7700/v1/refseq/query?q=(nt:CGGCAGTACTCAGCATGGTCTTATG)?source=Homo sapiens (human)?to=0&format=json
0.156 | 0.010 | count_done; http://172.18.8.71:7700/v1/refseq/query?q=(nt:CATGGTCTTATGCACAGGAACTAAA)?source=Homo sapiens (human)?to=0&format=json
0.167 | 0.010 | count_done; http://172.18.8.71:7700/v1/refseq/query?q=(nt:ATGTAAGGACCTGTGGCGCAATCCC)?source=Homo sapiens (human)?to=0&format=json
0.177 | 0.010 | count_done; http://172.18.8.71:7700/v1/refseq/query?q=(nt:ACCACAACTTCGCAGGATCTAACAA)?source=Homo sapiens (human)?to=0&format=json
0.187 | 0.010 | count_done; http://172.18.8.71:7700/v1/refseq/query?q=(nt:ACAAGATTGCTGAGATCCTATGTAA)?source=Homo sapiens (human)?to=0&format=json
0.197 | 0.010 | count_done; http://172.18.8.71:7700/v1/refseq/query?q=(nt:AAAGTTACAGCCATATGCAGGACGG)?source=Homo sapiens (human)?to=0&format=json
0.312 | 0.116 | search_done; http://172.18.8.71:7700/v1/refseq/query?q=(nt:TTCTCTGACCACAACTTCGCAGGAT)%26(nt:TGCAGGACGGCAGTACTCAGCATGG)%26(nt:GGGGACTCCCAGTTGTTGAGTTGAA)%26(nt:GGAGCATCAGATTTTACCTAATACA)%26(nt:GGAACAGAGACGTCAGGGGACTCCC)%26(nt:CGGCAGTACTCAGCATGGTCTTATG)%26(nt:CATGGTCTTATGCACAGGAACTAAA)%26(nt:ATGTAAGGACCTGTGGCGCAATCCC)%26(nt:ACCACAACTTCGCAGGATCTAACAA)%26(nt:ACAAGATTGCTGAGATCCTATGTAA)%26(nt:AAAGTTACAGCCATATGCAGGACGG)?source=Homo sapiens (human)?to=49?from=0?snippet=full_search?drilldown=source?get=accession,version,gi,length,symbol,synonym,geneid,division,source,definition&format=json
0.319 | 0.007 | cgi_end;

GGRNA ver.2 by @meso_cacase at DBCLS
This page is licensed under a Creative Commons Attribution 4.0 International License (CC BY 4.0).

If you use GGRNA in your work, please cite:
Naito Y, Bono H. (2012)
GGRNA: an ultrafast, transcript-oriented search engine for genes and transcripts.
Nucleic Acids Res., 40, W592-W596. [Full Text]