GGRNA ver.2 Help | Advanced search | Japanese    Previous release (v1)

2021-01-24 05:30:09, GGRNA : RefSeq release 203 (Nov, 2020)

Summary:

Results:

Matches are highlighted with green background. Overlapping matches are dark colored.

Homo sapiens myelin basic protein (MBP), transcript variant 4, mRNA. (2124 bp)
aatataactgccttaaaactttaatcccacttgcccctgttacctaattagagcagatgacccctcccctaatgcctgcggagttgtgcacgtagtagggtcaggccacggcagcctaccggcaatttccggccaacagttaaatgagaacatgaaaacagaaaacggttaaaactgtccctttctgtgtgaagatcacgttccttcccccgcaatgtgcccccagacgcacgtgggtcttcagggggccaggtgcacagacgtccctccacgttcacccctccacccttggactttcttttcgccgtggctgcggcacccttgcgcttttgctggtcactgccatggaggcacacagctgcagagacagagaggacgtgggcggcagagaggactgttgacatccaagcttcctttgtttttttttcctgtccttctctcacctcctaaagtagacttcatttttcctaacaggattagacagtcaaggagtggcttactacatgtgggagcttttggtatgtgacatgcgggctgggcagctgttagagtccaacgtggggcagcacagagagggggccacctccccaggccgtggct...
position 599 633 656 683 754 909 943 960 1002 1085 1115
NM_001025092.2 - Homo sapiens (human) - NCBI - UCSC - RefEx(expression)
Homo sapiens myelin basic protein (MBP), transcript variant 3, mRNA. (2157 bp)
aatataactgccttaaaactttaatcccacttgcccctgttacctaattagagcagatgacccctcccctaatgcctgcggagttgtgcacgtagtagggtcaggccacggcagcctaccggcaatttccggccaacagttaaatgagaacatgaaaacagaaaacggttaaaactgtccctttctgtgtgaagatcacgttccttcccccgcaatgtgcccccagacgcacgtgggtcttcagggggccaggtgcacagacgtccctccacgttcacccctccacccttggactttcttttcgccgtggctgcggcacccttgcgcttttgctggtcactgccatggaggcacacagctgcagagacagagaggacgtgggcggcagagaggactgttgacatccaagcttcctttgtttttttttcctgtccttctctcacctcctaaagtagacttcatttttcctaacaggattagacagtcaaggagtggcttactacatgtgggagcttttggtatgtgacatgcgggctgggcagctgttagagtccaacgtggggcagcacagagagggggccacctccccaggccgtggct...
position 632 666 689 716 787 942 976 993 1035 1118 1148
NM_001025090.2 - Homo sapiens (human) - NCBI - UCSC - RefEx(expression)
Homo sapiens myelin basic protein (MBP), transcript variant 2, mRNA. (2202 bp)
aatataactgccttaaaactttaatcccacttgcccctgttacctaattagagcagatgacccctcccctaatgcctgcggagttgtgcacgtagtagggtcaggccacggcagcctaccggcaatttccggccaacagttaaatgagaacatgaaaacagaaaacggttaaaactgtccctttctgtgtgaagatcacgttccttcccccgcaatgtgcccccagacgcacgtgggtcttcagggggccaggtgcacagacgtccctccacgttcacccctccacccttggactttcttttcgccgtggctgcggcacccttgcgcttttgctggtcactgccatggaggcacacagctgcagagacagagaggacgtgggcggcagagaggactgttgacatccaagcttcctttgtttttttttcctgtccttctctcacctcctaaagtagacttcatttttcctaacaggattagacagtcaaggagtggcttactacatgtgggagcttttggtatgtgacatgcgggctgggcagctgttagagtccaacgtggggcagcacagagagggggccacctccccaggccgtggct...
position 677 711 734 761 832 987 1021 1038 1080 1163 1193
NM_002385.3 - Homo sapiens (human) - NCBI - UCSC - RefEx(expression)
Homo sapiens myelin basic protein (MBP), transcript variant 1, mRNA. (2235 bp)
aatataactgccttaaaactttaatcccacttgcccctgttacctaattagagcagatgacccctcccctaatgcctgcggagttgtgcacgtagtagggtcaggccacggcagcctaccggcaatttccggccaacagttaaatgagaacatgaaaacagaaaacggttaaaactgtccctttctgtgtgaagatcacgttccttcccccgcaatgtgcccccagacgcacgtgggtcttcagggggccaggtgcacagacgtccctccacgttcacccctccacccttggactttcttttcgccgtggctgcggcacccttgcgcttttgctggtcactgccatggaggcacacagctgcagagacagagaggacgtgggcggcagagaggactgttgacatccaagcttcctttgtttttttttcctgtccttctctcacctcctaaagtagacttcatttttcctaacaggattagacagtcaaggagtggcttactacatgtgggagcttttggtatgtgacatgcgggctgggcagctgttagagtccaacgtggggcagcacagagagggggccacctccccaggccgtggct...
position 710 744 767 794 865 1020 1054 1071 1113 1196 1226
NM_001025081.2 - Homo sapiens (human) - NCBI - UCSC - RefEx(expression)
PREDICTED: Homo sapiens myelin basic protein (MBP), transcript variant X5, misc_RNA. (2415 bp)
aatataactgccttaaaactttaatcccacttgcccctgttacctaattagagcagatgacccctcccctaatgcctgcggagttgtgcacgtagtagggtcaggccacggcagcctaccggcaatttccggccaacagttaaatgagaacatgaaaacagaaaacggttaaaactgtccctttctgtgtgaagatcacgttccttcccccgcaatgtgcccccagacgcacgtgggtcttcagggggccaggtgcacagacgtccctccacgttcacccctccacccttggactttcttttcgccgtggctgcggcacccttgcgcttttgctggtcactgccatggaggcacacagctgcagagacagagaggacgtgggcggcagagaggactgttgacatccaagcttcctttgtttttttttcctgtccttctctcacctcctaaagtagacttcatttttcctaacaggattagacagtcaaggagtggcttactacatgtgggagcttttggtatgtgacatgcgggctgggcagctgttagagtccaacgtggggcagcacagagagggggccacctccccaggccgtggct...
position 890 924 947 974 1045 1200 1234 1251 1293 1376 1406
XR_001753202.1 - Homo sapiens (human) - NCBI - UCSC - RefEx(expression)
PREDICTED: Homo sapiens myelin basic protein (MBP), transcript variant X4, misc_RNA. (2448 bp)
aatataactgccttaaaactttaatcccacttgcccctgttacctaattagagcagatgacccctcccctaatgcctgcggagttgtgcacgtagtagggtcaggccacggcagcctaccggcaatttccggccaacagttaaatgagaacatgaaaacagaaaacggttaaaactgtccctttctgtgtgaagatcacgttccttcccccgcaatgtgcccccagacgcacgtgggtcttcagggggccaggtgcacagacgtccctccacgttcacccctccacccttggactttcttttcgccgtggctgcggcacccttgcgcttttgctggtcactgccatggaggcacacagctgcagagacagagaggacgtgggcggcagagaggactgttgacatccaagcttcctttgtttttttttcctgtccttctctcacctcctaaagtagacttcatttttcctaacaggattagacagtcaaggagtggcttactacatgtgggagcttttggtatgtgacatgcgggctgggcagctgttagagtccaacgtggggcagcacagagagggggccacctccccaggccgtggct...
position 923 957 980 1007 1078 1233 1267 1284 1326 1409 1439
XR_001753201.1 - Homo sapiens (human) - NCBI - UCSC - RefEx(expression)
Homo sapiens myelin basic protein (MBP), transcript variant 7, mRNA. (2738 bp)
aatataactgccttaaaactttaatcccacttgcccctgttacctaattagagcagatgacccctcccctaatgcctgcggagttgtgcacgtagtagggtcaggccacggcagcctaccggcaatttccggccaacagttaaatgagaacatgaaaacagaaaacggttaaaactgtccctttctgtgtgaagatcacgttccttcccccgcaatgtgcccccagacgcacgtgggtcttcagggggccaggtgcacagacgtccctccacgttcacccctccacccttggactttcttttcgccgtggctgcggcacccttgcgcttttgctggtcactgccatggaggcacacagctgcagagacagagaggacgtgggcggcagagaggactgttgacatccaagcttcctttgtttttttttcctgtccttctctcacctcctaaagtagacttcatttttcctaacaggattagacagtcaaggagtggcttactacatgtgggagcttttggtatgtgacatgcgggctgggcagctgttagagtccaacgtggggcagcacagagagggggccacctccccaggccgtggct...
position 1213 1247 1270 1297 1368 1523 1557 1574 1616 1699 1729
NM_001025101.2 - Homo sapiens (human) - NCBI - UCSC - RefEx(expression)

Data Export:

Maximum 10000 results can be retrieved as Tab-delimited text or JSON format.

Debug Info:

Redirect URI : http://ggrna.dbcls.jp/hs/207323_s_at
lang : en | div : | spe : hs | query_string : 207323_s_at | format : html | download :

0.000 | 0.000 | search_start;
0.108 | 0.108 | count_done; http://172.18.8.71:7700/v1/refseq/query?q=(nt:TTGCCCCTGTTACCTAATTAGAGCA)?source=Homo sapiens (human)?to=0&format=json
0.120 | 0.012 | count_done; http://172.18.8.71:7700/v1/refseq/query?q=(nt:TGTGTGAAGATCACGTTCCTTCCCC)?source=Homo sapiens (human)?to=0&format=json
0.131 | 0.011 | count_done; http://172.18.8.71:7700/v1/refseq/query?q=(nt:TGGTATGTGACATGCGGGCTGGGCA)?source=Homo sapiens (human)?to=0&format=json
0.141 | 0.010 | count_done; http://172.18.8.71:7700/v1/refseq/query?q=(nt:TGCCATGGAGGCACACAGCTGCAGA)?source=Homo sapiens (human)?to=0&format=json
0.153 | 0.012 | count_done; http://172.18.8.71:7700/v1/refseq/query?q=(nt:TCCCCTAATGCCTGCGGAGTTGTGC)?source=Homo sapiens (human)?to=0&format=json
0.163 | 0.010 | count_done; http://172.18.8.71:7700/v1/refseq/query?q=(nt:TAGAGTCCAACGTGGGGCAGCACAG)?source=Homo sapiens (human)?to=0&format=json
0.173 | 0.010 | count_done; http://172.18.8.71:7700/v1/refseq/query?q=(nt:GGACTGTTGACATCCAAGCTTCCTT)?source=Homo sapiens (human)?to=0&format=json
0.184 | 0.010 | count_done; http://172.18.8.71:7700/v1/refseq/query?q=(nt:GCACGTAGTAGGGTCAGGCCACGGC)?source=Homo sapiens (human)?to=0&format=json
0.194 | 0.010 | count_done; http://172.18.8.71:7700/v1/refseq/query?q=(nt:GACGTGGGCGGCAGAGAGGACTGTT)?source=Homo sapiens (human)?to=0&format=json
0.204 | 0.009 | count_done; http://172.18.8.71:7700/v1/refseq/query?q=(nt:CTTCTCTCACCTCCTAAAGTAGACT)?source=Homo sapiens (human)?to=0&format=json
0.214 | 0.011 | count_done; http://172.18.8.71:7700/v1/refseq/query?q=(nt:CCTACCGGCAATTTCCGGCCAACAG)?source=Homo sapiens (human)?to=0&format=json
0.343 | 0.129 | search_done; http://172.18.8.71:7700/v1/refseq/query?q=(nt:TTGCCCCTGTTACCTAATTAGAGCA)%26(nt:TGTGTGAAGATCACGTTCCTTCCCC)%26(nt:TGGTATGTGACATGCGGGCTGGGCA)%26(nt:TGCCATGGAGGCACACAGCTGCAGA)%26(nt:TCCCCTAATGCCTGCGGAGTTGTGC)%26(nt:TAGAGTCCAACGTGGGGCAGCACAG)%26(nt:GGACTGTTGACATCCAAGCTTCCTT)%26(nt:GCACGTAGTAGGGTCAGGCCACGGC)%26(nt:GACGTGGGCGGCAGAGAGGACTGTT)%26(nt:CTTCTCTCACCTCCTAAAGTAGACT)%26(nt:CCTACCGGCAATTTCCGGCCAACAG)?source=Homo sapiens (human)?to=49?from=0?snippet=full_search?drilldown=source?get=accession,version,gi,length,symbol,synonym,geneid,division,source,definition&format=json
0.347 | 0.004 | cgi_end;

GGRNA ver.2 by @meso_cacase at DBCLS
This page is licensed under a Creative Commons Attribution 4.0 International License (CC BY 4.0).

If you use GGRNA in your work, please cite:
Naito Y, Bono H. (2012)
GGRNA: an ultrafast, transcript-oriented search engine for genes and transcripts.
Nucleic Acids Res., 40, W592-W596. [Full Text]