GGRNA ver.2 Help | Advanced search | Japanese    Previous release (v1)

2021-01-24 04:46:25, GGRNA : RefSeq release 203 (Nov, 2020)

Summary:

Results:

Matches are highlighted with green background. Overlapping matches are dark colored.

Homo sapiens calmodulin 2 (CALM2), transcript variant 2, mRNA. (1210 bp)
ttgtacagaatgtgttaaatttcttgtacaaaattgtttatttgccttttctttgtttgtaacttatctgtaaaaggtttctccctactgtcaaaaaaatatgcatgtatagtaattaggacttcattcctccatgttttcttcccttatcttactgtcattgtcctaaaaccttattttagaaaattgatcaagtaacatgttgcatgtggcttactctggatatatctaagcccttctgcacatctaaacttagatggagttggtcaaatgagggaacatctgggttatgccttttttaaagtagttttctttaggaactgtcagcatgttgttgttgaagtgtggagttgtaactctgcgtggactatggacagtcaacaatatgtacttaaaagttgcactattgcaaaacgggtgtattatccaggtactcgtacactatttttttgtactgctggtcctgtaccagaaacattttcttttattgttacttgctttttaaactttgtttagccacttaaaatctgcttatggcacaatttgcctcaaaatccattccaagttgtatatttgttttccaataaaaaaattacaatt...
position 573 589 592 639 774 796 799 870 874 878 1050
Synonym: CALM; CALML2; caM; CAM1; CAM3; CAMC; CAMII; CAMIII; LQT15; PHKD; PHKD2
NM_001743.6 - Homo sapiens (human) - NCBI - UCSC - RefEx(expression)
Homo sapiens calmodulin 2 (CALM2), transcript variant 3, mRNA. (1227 bp)
ttgtacagaatgtgttaaatttcttgtacaaaattgtttatttgccttttctttgtttgtaacttatctgtaaaaggtttctccctactgtcaaaaaaatatgcatgtatagtaattaggacttcattcctccatgttttcttcccttatcttactgtcattgtcctaaaaccttattttagaaaattgatcaagtaacatgttgcatgtggcttactctggatatatctaagcccttctgcacatctaaacttagatggagttggtcaaatgagggaacatctgggttatgccttttttaaagtagttttctttaggaactgtcagcatgttgttgttgaagtgtggagttgtaactctgcgtggactatggacagtcaacaatatgtacttaaaagttgcactattgcaaaacgggtgtattatccaggtactcgtacactatttttttgtactgctggtcctgtaccagaaacattttcttttattgttacttgctttttaaactttgtttagccacttaaaatctgcttatggcacaatttgcctcaaaatccattccaagttgtatatttgttttccaataaaaaaattacaatt...
position 590 606 609 656 791 813 816 887 891 895 1067
Synonym: CALM; CALML2; caM; CAM1; CAM3; CAMC; CAMII; CAMIII; LQT15; PHKD; PHKD2
NM_001305625.2 - Homo sapiens (human) - NCBI - UCSC - RefEx(expression)
Homo sapiens calmodulin 2 (CALM2), transcript variant 1, mRNA. (1377 bp)
ttgtacagaatgtgttaaatttcttgtacaaaattgtttatttgccttttctttgtttgtaacttatctgtaaaaggtttctccctactgtcaaaaaaatatgcatgtatagtaattaggacttcattcctccatgttttcttcccttatcttactgtcattgtcctaaaaccttattttagaaaattgatcaagtaacatgttgcatgtggcttactctggatatatctaagcccttctgcacatctaaacttagatggagttggtcaaatgagggaacatctgggttatgccttttttaaagtagttttctttaggaactgtcagcatgttgttgttgaagtgtggagttgtaactctgcgtggactatggacagtcaacaatatgtacttaaaagttgcactattgcaaaacgggtgtattatccaggtactcgtacactatttttttgtactgctggtcctgtaccagaaacattttcttttattgttacttgctttttaaactttgtttagccacttaaaatctgcttatggcacaatttgcctcaaaatccattccaagttgtatatttgttttccaataaaaaaattacaatt...
position 731 747 750 797 932 954 957 1028 1032 1036 1208
Synonym: CALM; CALML2; caM; CAM1; CAM3; CAMC; CAMII; CAMIII; LQT15; PHKD; PHKD2
NM_001305624.1 - Homo sapiens (human) - NCBI - UCSC - RefEx(expression)
Homo sapiens calmodulin 2 (CALM2), transcript variant 4, mRNA. (4591 bp)
ttgtacagaatgtgttaaatttcttgtacaaaattgtttatttgccttttctttgtttgtaacttatctgtaaaaggtttctccctactgtcaaaaaaatatgcatgtatagtaattaggacttcattcctccatgttttcttcccttatcttactgtcattgtcctaaaaccttattttagaaaattgatcaagtaacatgttgcatgtggcttactctggatatatctaagcccttctgcacatctaaacttagatggagttggtcaaatgagggaacatctgggttatgccttttttaaagtagttttctttaggaactgtcagcatgttgttgttgaagtgtggagttgtaactctgcgtggactatggacagtcaacaatatgtacttaaaagttgcactattgcaaaacgggtgtattatccaggtactcgtacactatttttttgtactgctggtcctgtaccagaaacattttcttttattgttacttgctttttaaactttgtttagccacttaaaatctgcttatggcacaatttgcctcaaaatccattccaagttgtatatttgttttccaataaaaaaattacaatt...
position 3945 3961 3964 4011 4146 4168 4171 4242 4246 4250 4422
Synonym: CALM; CALML2; caM; CAM1; CAM3; CAMC; CAMII; CAMIII; LQT15; PHKD; PHKD2
NM_001305626.1 - Homo sapiens (human) - NCBI - UCSC - RefEx(expression)

Data Export:

Maximum 10000 results can be retrieved as Tab-delimited text or JSON format.

Debug Info:

Redirect URI : http://ggrna.dbcls.jp/hs/207243_s_at
lang : en | div : | spe : hs | query_string : 207243_s_at | format : html | download :

0.000 | 0.000 | search_start;
0.097 | 0.097 | count_done; http://172.18.8.71:7700/v1/refseq/query?q=(nt:TTGTAACTCTGCGTGGACTATGGAC)?source=Homo sapiens (human)?to=0&format=json
0.110 | 0.013 | count_done; http://172.18.8.71:7700/v1/refseq/query?q=(nt:TTAGGACTTCATTCCTCCATGTTTT)?source=Homo sapiens (human)?to=0&format=json
0.125 | 0.015 | count_done; http://172.18.8.71:7700/v1/refseq/query?q=(nt:TGTAAAAGGTTTCTCCCTACTGTCA)?source=Homo sapiens (human)?to=0&format=json
0.136 | 0.011 | count_done; http://172.18.8.71:7700/v1/refseq/query?q=(nt:TCTTTGTTTGTAACTTATCTGTAAA)?source=Homo sapiens (human)?to=0&format=json
0.429 | 0.293 | count_done; http://172.18.8.71:7700/v1/refseq/query?q=(nt:TCTGCTTATGGCACAATTTGCCTCA)?source=Homo sapiens (human)?to=0&format=json
0.439 | 0.010 | count_done; http://172.18.8.71:7700/v1/refseq/query?q=(nt:GGAGTTGTAACTCTGCGTGGACTAT)?source=Homo sapiens (human)?to=0&format=json
0.448 | 0.009 | count_done; http://172.18.8.71:7700/v1/refseq/query?q=(nt:GGAACATCTGGGTTATGCCTTTTTT)?source=Homo sapiens (human)?to=0&format=json
0.458 | 0.010 | count_done; http://172.18.8.71:7700/v1/refseq/query?q=(nt:GAGGGAACATCTGGGTTATGCCTTT)?source=Homo sapiens (human)?to=0&format=json
0.469 | 0.012 | count_done; http://172.18.8.71:7700/v1/refseq/query?q=(nt:ATCTGTAAAAGGTTTCTCCCTACTG)?source=Homo sapiens (human)?to=0&format=json
0.480 | 0.011 | count_done; http://172.18.8.71:7700/v1/refseq/query?q=(nt:ACTTAGATGGAGTTGGTCAAATGAG)?source=Homo sapiens (human)?to=0&format=json
0.489 | 0.009 | count_done; http://172.18.8.71:7700/v1/refseq/query?q=(nt:AACTCTGCGTGGACTATGGACAGTC)?source=Homo sapiens (human)?to=0&format=json
0.578 | 0.088 | search_done; http://172.18.8.71:7700/v1/refseq/query?q=(nt:TTGTAACTCTGCGTGGACTATGGAC)%26(nt:TTAGGACTTCATTCCTCCATGTTTT)%26(nt:TGTAAAAGGTTTCTCCCTACTGTCA)%26(nt:TCTTTGTTTGTAACTTATCTGTAAA)%26(nt:TCTGCTTATGGCACAATTTGCCTCA)%26(nt:GGAGTTGTAACTCTGCGTGGACTAT)%26(nt:GGAACATCTGGGTTATGCCTTTTTT)%26(nt:GAGGGAACATCTGGGTTATGCCTTT)%26(nt:ATCTGTAAAAGGTTTCTCCCTACTG)%26(nt:ACTTAGATGGAGTTGGTCAAATGAG)%26(nt:AACTCTGCGTGGACTATGGACAGTC)?source=Homo sapiens (human)?to=49?from=0?snippet=full_search?drilldown=source?get=accession,version,gi,length,symbol,synonym,geneid,division,source,definition&format=json
0.581 | 0.003 | cgi_end;

GGRNA ver.2 by @meso_cacase at DBCLS
This page is licensed under a Creative Commons Attribution 4.0 International License (CC BY 4.0).

If you use GGRNA in your work, please cite:
Naito Y, Bono H. (2012)
GGRNA: an ultrafast, transcript-oriented search engine for genes and transcripts.
Nucleic Acids Res., 40, W592-W596. [Full Text]