GGRNA ver.2 Help | Advanced search | Japanese    Previous release (v1)

2021-01-17 00:13:44, GGRNA : RefSeq release 203 (Nov, 2020)

Summary:

Results:

Matches are highlighted with green background. Overlapping matches are dark colored.

Homo sapiens inter-alpha-trypsin inhibitor heavy chain 4 (ITIH4), transcript variant 2, mRNA. (3192 bp)
gaccctgagcaaggggttgaggtgactggccagtatgagagggagaaggctgggttctcatggatcgaagtgaccttcaagaaccccctggtatgggttcacgcatcccctgaacacgtggtggtgactcggaaccgaagaagctctgcgtacaagtggaaggagacgctattctcagtgatgcccggcctgaagatgaccatggacaagacgggtctcctgctgctcagtgacccagacaaagtgaccatcggcctgttgttctgggatggccgtggggaggggctccggctccttctgcgtgacactgaccgcttctccagccacgttggagggacccttggccagttttaccaggaggtgctctggggatctccagcagcatcagatgacggcagacgcacgctgagggttcagggcaatgaccactctgccaccagagagcgcaggctggattaccaggaggggcccccgggagtggagatttcctgctggtctgtggagctgtagttctgatggaaggagctgtgcccaccctgtacacttggcttccccctgcaactgcagggccgcttctggggcctggaccaccatggggag...
position 2327 2354 2386 2405 2424 2461 2548 2585 2636 2652 2697
Synonym: GP120; H4P; IHRP; ITI-HC4; ITIHL1; PK-120; PK120
NM_001166449.2 - Homo sapiens (human) - NCBI - UCSC - RefEx(expression)
Homo sapiens inter-alpha-trypsin inhibitor heavy chain 4 (ITIH4), transcript variant 1, mRNA. (3282 bp)
gaccctgagcaaggggttgaggtgactggccagtatgagagggagaaggctgggttctcatggatcgaagtgaccttcaagaaccccctggtatgggttcacgcatcccctgaacacgtggtggtgactcggaaccgaagaagctctgcgtacaagtggaaggagacgctattctcagtgatgcccggcctgaagatgaccatggacaagacgggtctcctgctgctcagtgacccagacaaagtgaccatcggcctgttgttctgggatggccgtggggaggggctccggctccttctgcgtgacactgaccgcttctccagccacgttggagggacccttggccagttttaccaggaggtgctctggggatctccagcagcatcagatgacggcagacgcacgctgagggttcagggcaatgaccactctgccaccagagagcgcaggctggattaccaggaggggcccccgggagtggagatttcctgctggtctgtggagctgtagttctgatggaaggagctgtgcccaccctgtacacttggcttccccctgcaactgcagggccgcttctggggcctggaccaccatggggag...
position 2417 2444 2476 2495 2514 2551 2638 2675 2726 2742 2787
Synonym: GP120; H4P; IHRP; ITI-HC4; ITIHL1; PK-120; PK120
NM_002218.5 - Homo sapiens (human) - NCBI - UCSC - RefEx(expression)

Data Export:

Maximum 10000 results can be retrieved as Tab-delimited text or JSON format.

Debug Info:

Redirect URI : http://ggrna.dbcls.jp/hs/206287_s_at
lang : en | div : | spe : hs | query_string : 206287_s_at | format : html | download :

0.000 | 0.000 | search_start;
0.085 | 0.085 | count_done; http://172.18.8.71:7700/v1/refseq/query?q=(nt:TTCAGGGCAATGACCACTCTGCCAC)?source=Homo sapiens (human)?to=0&format=json
0.097 | 0.012 | count_done; http://172.18.8.71:7700/v1/refseq/query?q=(nt:TGCTCTGGGGATCTCCAGCAGCATC)?source=Homo sapiens (human)?to=0&format=json
0.108 | 0.012 | count_done; http://172.18.8.71:7700/v1/refseq/query?q=(nt:TGCCCGGCCTGAAGATGACCATGGA)?source=Homo sapiens (human)?to=0&format=json
0.120 | 0.011 | count_done; http://172.18.8.71:7700/v1/refseq/query?q=(nt:GGGAGTGGAGATTTCCTGCTGGTCT)?source=Homo sapiens (human)?to=0&format=json
0.131 | 0.011 | count_done; http://172.18.8.71:7700/v1/refseq/query?q=(nt:GGAACCGAAGAAGCTCTGCGTACAA)?source=Homo sapiens (human)?to=0&format=json
0.141 | 0.010 | count_done; http://172.18.8.71:7700/v1/refseq/query?q=(nt:GAGACGCTATTCTCAGTGATGCCCG)?source=Homo sapiens (human)?to=0&format=json
0.152 | 0.011 | count_done; http://172.18.8.71:7700/v1/refseq/query?q=(nt:GACAAAGTGACCATCGGCCTGTTGT)?source=Homo sapiens (human)?to=0&format=json
0.163 | 0.011 | count_done; http://172.18.8.71:7700/v1/refseq/query?q=(nt:CTCTGCCACCAGAGAGCGCAGGCTG)?source=Homo sapiens (human)?to=0&format=json
0.174 | 0.011 | count_done; http://172.18.8.71:7700/v1/refseq/query?q=(nt:CATGGACAAGACGGGTCTCCTGCTG)?source=Homo sapiens (human)?to=0&format=json
0.184 | 0.010 | count_done; http://172.18.8.71:7700/v1/refseq/query?q=(nt:CATCCCCTGAACACGTGGTGGTGAC)?source=Homo sapiens (human)?to=0&format=json
0.194 | 0.010 | count_done; http://172.18.8.71:7700/v1/refseq/query?q=(nt:CACGTTGGAGGGACCCTTGGCCAGT)?source=Homo sapiens (human)?to=0&format=json
0.230 | 0.036 | search_done; http://172.18.8.71:7700/v1/refseq/query?q=(nt:TTCAGGGCAATGACCACTCTGCCAC)%26(nt:TGCTCTGGGGATCTCCAGCAGCATC)%26(nt:TGCCCGGCCTGAAGATGACCATGGA)%26(nt:GGGAGTGGAGATTTCCTGCTGGTCT)%26(nt:GGAACCGAAGAAGCTCTGCGTACAA)%26(nt:GAGACGCTATTCTCAGTGATGCCCG)%26(nt:GACAAAGTGACCATCGGCCTGTTGT)%26(nt:CTCTGCCACCAGAGAGCGCAGGCTG)%26(nt:CATGGACAAGACGGGTCTCCTGCTG)%26(nt:CATCCCCTGAACACGTGGTGGTGAC)%26(nt:CACGTTGGAGGGACCCTTGGCCAGT)?source=Homo sapiens (human)?to=49?from=0?snippet=full_search?drilldown=source?get=accession,version,gi,length,symbol,synonym,geneid,division,source,definition&format=json
0.231 | 0.002 | cgi_end;

GGRNA ver.2 by @meso_cacase at DBCLS
This page is licensed under a Creative Commons Attribution 4.0 International License (CC BY 4.0).

If you use GGRNA in your work, please cite:
Naito Y, Bono H. (2012)
GGRNA: an ultrafast, transcript-oriented search engine for genes and transcripts.
Nucleic Acids Res., 40, W592-W596. [Full Text]