GGRNA ver.2 Help | Advanced search | Japanese    Previous release (v1)

2018-08-18 22:52:50, GGRNA : RefSeq release 89 (Jul, 2018)

Summary:

Results:

Matches are highlighted with green background. Overlapping matches are dark colored.

Homo sapiens tryptophan 2,3-dioxygenase (TDO2), mRNA. (1703 bp)
gctggcaccggtggttcctcaggctatcactacctgcgatcaactgtgagtgataggtacaaggtatttgtagatttatttaatctttcaacatacctgattccccgacactggataccgaagatgaacccaaccattcacaaatttctatatacagcagaatactgtgatagctcctacttcagcagtgatgaatcagattaaaatcgtctgcaaaatctatgaagaatactggtttcacagcctattttttattttctatggattttcataaatacagtttgaatatatgtatgcatatattgttcagcaccacgatgctctgatttaattctagaaacaatttgattacctcttgtttgtgacaagactaagcattaagatgagaaagaatacatttaaatagtaacattgtacatagggtgttttcctattaaaaattcagtttcccctgagacttaatgtaaccacttaatgtaatcactatctcattgtttcatctttataaacttgtaaacttcatctatttcaaatattttatgcagtacattatattattctgtacaaaggctttcaaacaaaatttttaaaataataaag...
position 1183 1196 1210 1240 1252 1314 1384 1393 1426 1529 1560
Synonym: HYPTRP; TDO; TO; TPH2; TRPO
NM_005651.3 - Homo sapiens (human) - NCBI - UCSC - RefEx(expression)

Data Export:

Maximum 10000 results can be retrieved as Tab-delimited text or JSON format.

Debug Info:

Redirect URI : http://ggrna.dbcls.jp/hs/205943_at
lang : en | div : | spe : hs | query_string : 205943_at | format : html | download :

0.000 | 0.000 | search_start;
0.083 | 0.083 | count_done; http://172.18.8.71:7700/v1/refseq/query?q=(nt:TTTCCCCTGAGACTTAATGTAACCA)?source=Homo sapiens (human)?to=0&format=json
0.093 | 0.010 | count_done; http://172.18.8.71:7700/v1/refseq/query?q=(nt:TATTGTTCAGCACCACGATGCTCTG)?source=Homo sapiens (human)?to=0&format=json
0.101 | 0.008 | count_done; http://172.18.8.71:7700/v1/refseq/query?q=(nt:GTAATCACTATCTCATTGTTTCATC)?source=Homo sapiens (human)?to=0&format=json
0.110 | 0.008 | count_done; http://172.18.8.71:7700/v1/refseq/query?q=(nt:GGATACCGAAGATGAACCCAACCAT)?source=Homo sapiens (human)?to=0&format=json
0.116 | 0.007 | count_done; http://172.18.8.71:7700/v1/refseq/query?q=(nt:GCAGAATACTGTGATAGCTCCTACT)?source=Homo sapiens (human)?to=0&format=json
0.124 | 0.008 | count_done; http://172.18.8.71:7700/v1/refseq/query?q=(nt:GCACCACGATGCTCTGATTTAATTC)?source=Homo sapiens (human)?to=0&format=json
0.133 | 0.008 | count_done; http://172.18.8.71:7700/v1/refseq/query?q=(nt:GATAGCTCCTACTTCAGCAGTGATG)?source=Homo sapiens (human)?to=0&format=json
0.142 | 0.009 | count_done; http://172.18.8.71:7700/v1/refseq/query?q=(nt:ATTTGATTACCTCTTGTTTGTGACA)?source=Homo sapiens (human)?to=0&format=json
0.152 | 0.010 | count_done; http://172.18.8.71:7700/v1/refseq/query?q=(nt:ATTCCCCGACACTGGATACCGAAGA)?source=Homo sapiens (human)?to=0&format=json
0.160 | 0.009 | count_done; http://172.18.8.71:7700/v1/refseq/query?q=(nt:ACTGGTTTCACAGCCTATTTTTTAT)?source=Homo sapiens (human)?to=0&format=json
0.170 | 0.009 | count_done; http://172.18.8.71:7700/v1/refseq/query?q=(nt:AACCCAACCATTCACAAATTTCTAT)?source=Homo sapiens (human)?to=0&format=json
0.196 | 0.027 | search_done; http://172.18.8.71:7700/v1/refseq/query?q=(nt:TTTCCCCTGAGACTTAATGTAACCA)%26(nt:TATTGTTCAGCACCACGATGCTCTG)%26(nt:GTAATCACTATCTCATTGTTTCATC)%26(nt:GGATACCGAAGATGAACCCAACCAT)%26(nt:GCAGAATACTGTGATAGCTCCTACT)%26(nt:GCACCACGATGCTCTGATTTAATTC)%26(nt:GATAGCTCCTACTTCAGCAGTGATG)%26(nt:ATTTGATTACCTCTTGTTTGTGACA)%26(nt:ATTCCCCGACACTGGATACCGAAGA)%26(nt:ACTGGTTTCACAGCCTATTTTTTAT)%26(nt:AACCCAACCATTCACAAATTTCTAT)?source=Homo sapiens (human)?to=49?from=0?snippet=full_search?drilldown=source?get=accession,version,gi,length,symbol,synonym,geneid,division,source,definition&format=json
0.197 | 0.001 | cgi_end;

GGRNA ver.2 by @meso_cacase at DBCLS
This page is licensed under a Creative Commons Attribution 4.0 International License (CC BY 4.0).

If you use GGRNA in your work, please cite:
Naito Y, Bono H. (2012)
GGRNA: an ultrafast, transcript-oriented search engine for genes and transcripts.
Nucleic Acids Res., 40, W592-W596. [Full Text]