GGRNA ver.2 Help | Advanced search | Japanese    Previous release (v1)

2021-04-24 00:23:21, GGRNA : RefSeq release 205 (Mar, 2021)

Summary:

Results:

Matches are highlighted with green background. Overlapping matches are dark colored.

Homo sapiens small nuclear ribonucleoprotein polypeptide G (SNRPG), transcript variant 4, mRNA. (548 bp)
ribonucleoprotein reconstituted in vitro JOURNAL J Mol Biol 227 (1), 15-28 (1992) PUBMED 1387914 ggaaggaagtgtttttaaaactacgtgaggcatcagaatccgaaagccactttagtcttagcaaatgtgtttatttatggacaagaagttatcattgaaattaaatggtggcagacatgtccaaggaatattgcggggatttgatccctttatgaaccttgtgatagatgaatgtgtggagatggcgactagtggacaacagaacaatattggaatggtggtaatacgaggaaatagtatcatcatgttagaagccttggaacgagtataaataatggctgttcagcagagaaacccatgtcctctctccatagggcctgttttactatgatgtaaaaattaggtcatgtacattttcatattagactttttgttaaataaacttttgtaatagtcaaaaatgctttctcagatgttctgaatatagaatatcagctctcattccagttttttctaacatgaattttcctggttgacattgatttcaaagggttttatgcatt...
position 106 123 137 143 154 173 181 236 247 276 284
Synonym: Sm-G; SMG
NM_001317167.1 - Homo sapiens (human) - NCBI - UCSC - RefEx(expression)
Homo sapiens small nuclear ribonucleoprotein polypeptide G (SNRPG), transcript variant 7, mRNA. (571 bp)
in vitro JOURNAL J Mol Biol 227 (1), 15-28 (1992) PUBMED 1387914 gccagacgcaagacgccgggcctacagcgggagcgtgaggaaagccgtgcgttgcgttccaaggcatctgtgagcccgcggagtatacaccatgagcaaagctcaccctcccgagttgaaaaatgaaattaaatggtggcagacatgtccaaggaatattgcggggatttgatccctttatgaaccttgtgatagatgaatgtgtggagatggcgactagtggacaacagaacaatattggaatggtggtaatacgaggaaatagtatcatcatgttagaagccttggaacgagtataaataatggctgttcagcagagaaacccatgtcctctctccatagggcctgttttactatgatgtaaaaattaggtcatgtacattttcatattagactttttgttaaataaacttttgtaatagtcaaaaatgctttctcagatgttctgaatatagaatatcagctctcattccagttttttctaacatgaattttcctggttgacattgatttcaaagggttttatgcattaaag...
position 134 151 165 171 182 201 209 264 275 304 312
Synonym: Sm-G; SMG
NM_001317171.2 - Homo sapiens (human) - NCBI - UCSC - RefEx(expression)
Homo sapiens small nuclear ribonucleoprotein polypeptide G (SNRPG), transcript variant 3, mRNA. (591 bp)
Mol Biol 227 (1), 15-28 (1992) PUBMED 1387914 gccagacgcaagacgccgggcctacagcgggagcgtgaggaaagccgtgcgttgcgttccaaggcatctgtgagcccgcggagtatacaccatgagcaaagctcaccctcccgagttgaaaaaatttatggacaagaagttatcattgaaattaaatggtggcagacatgtccaaggaatattgcggggatttgatccctttatgaaccttgtgatagatgaatgtgtggagatggcgactagtggacaacagaacaatattggaatggtaatacgaggaaatagtatcatcatgttagaagccttggaacgagtataaataatggctgttcagcagagaaacccatgtcctctctccatagggcctgttttactatgatgtaaaaattaggtcatgtacattttcatattagactttttgttaaataaacttttgtaatagtcaaaaatgctttctcagatgttctgaatatagaatatcagctctcattccagttttttctaacatgaattttcctggttgacattgatttcaaagggttttatgcattaaa...
position 157 174 188 194 205 224 232 284 295 324 332
Synonym: Sm-G; SMG
NM_001317166.2 - Homo sapiens (human) - NCBI - UCSC - RefEx(expression)
Homo sapiens small nuclear ribonucleoprotein polypeptide G (SNRPG), transcript variant 1, mRNA. (594 bp)
Mol Biol 227 (1), 15-28 (1992) PUBMED 1387914 gccagacgcaagacgccgggcctacagcgggagcgtgaggaaagccgtgcgttgcgttccaaggcatctgtgagcccgcggagtatacaccatgagcaaagctcaccctcccgagttgaaaaaatttatggacaagaagttatcattgaaattaaatggtggcagacatgtccaaggaatattgcggggatttgatccctttatgaaccttgtgatagatgaatgtgtggagatggcgactagtggacaacagaacaatattggaatggtggtaatacgaggaaatagtatcatcatgttagaagccttggaacgagtataaataatggctgttcagcagagaaacccatgtcctctctccatagggcctgttttactatgatgtaaaaattaggtcatgtacattttcatattagactttttgttaaataaacttttgtaatagtcaaaaatgctttctcagatgttctgaatatagaatatcagctctcattccagttttttctaacatgaattttcctggttgacattgatttcaaagggttttatgcatt...
position 157 174 188 194 205 224 232 287 298 327 335
Synonym: Sm-G; SMG
NM_003096.4 - Homo sapiens (human) - NCBI - UCSC - RefEx(expression)
Homo sapiens small nuclear ribonucleoprotein polypeptide G (SNRPG), transcript variant 6, mRNA. (657 bp)
ggtgtggttacagccggcagccacggcacctccttccggccgactagtctccaggtcccgcggtctggcccctggtcacccggcgctgtccctcgttccttgaagatctccagtgctaccttttgttgaacatctcgaatacaccaaaccttctagctgctaatactcagatttatggacaagaagttatcattgaaattaaatggtggcagacatgtccaaggaatattgcggggatttgatccctttatgaaccttgtgatagatgaatgtgtggagatggcgactagtggacaacagaacaatattggaatggtggtaatacgaggaaatagtatcatcatgttagaagccttggaacgagtataaataatggctgttcagcagagaaacccatgtcctctctccatagggcctgttttactatgatgtaaaaattaggtcatgtacattttcatattagactttttgttaaataaacttttgtaatagtcaaaaatgctttctcagatgttctgaatatagaatatcagctctcattccagttttttctaacatgaattttcctggttgacattgatttcaaagggttttatgcat...
position 220 237 251 257 268 287 295 350 361 390 398
Synonym: Sm-G; SMG
NM_001317169.2 - Homo sapiens (human) - NCBI - UCSC - RefEx(expression)
Homo sapiens small nuclear ribonucleoprotein polypeptide G (SNRPG), transcript variant 2, mRNA. (701 bp)
gcaagacgccgggcctacagcgggagcgtgaggaaagccgtgcgttgcgttccaaggcatctgtgagcccgcggagtatacaccatgagcaaagctcaccctcccgagttgaaaaaatttatggacaagaagttatcattgaaattaaatggtggcagacatgtccaaggaatattgcggggatttgatccctttatgaaccttgtgatagatgaatgtgtggagatggcgactagtggacaacagaacaatattggaatggtggacaacatacctaataaagcggtaagcccaaagttcttgaaaaaggtgaaccaaaaaggacaacttacttttagcaaattattaagcataaagacctccaaggagtggtaatacgaggaaatagtatcatcatgttagaagccttggaacgagtataaataatggctgttcagcagagaaacccatgtcctctctccatagggcctgttttactatgatgtaaaaattaggtcatgtacattttcatattagactttttgttaaataaacttttgtaatagtcaaaaatgctttctcagatgttctgaatatagaatatcagctctcattccagtt...
position 157 174 188 194 205 224 232 394 405 434 442
Synonym: Sm-G; SMG
NM_001317165.2 - Homo sapiens (human) - NCBI - UCSC - RefEx(expression)
Homo sapiens small nuclear ribonucleoprotein polypeptide G (SNRPG), transcript variant 5, mRNA. (1260 bp)
acgtttctgttttgcttatacttcctgatgctggaattctacatgtattagttggattgcacaaaggatgcaaaatttttacagggatcagttttttctggcgtagcatgtggttggctttgtgtatagttagttcatttattaccaggcccatggaagtcagacaaaagatttatggacaagaagttatcattgaaattaaatggtggcagacatgtccaaggaatattgcggggatttgatccctttatgaaccttgtgatagatgaatgtgtggagatggcgactagtggacaacagaacaatattggaatggtggtaatacgaggaaatagtatcatcatgttagaagccttggaacgagtataaataatggctgttcagcagagaaacccatgtcctctctccatagggcctgttttactatgatgtaaaaattaggtcatgtacattttcatattagactttttgttaaataaacttttgtaatagtcaaaaatgctttctcagatgttctgaatatagaatatcagctctcattccagttttttctaacatgaattttcctggttgacattgatttcaaagggttttatgcat...
position 818 835 849 855 866 885 893 948 959 988 996
Synonym: Sm-G; SMG
NM_001317168.1 - Homo sapiens (human) - NCBI - UCSC - RefEx(expression)

Data Export:

Maximum 10000 results can be retrieved as Tab-delimited text or JSON format.

Debug Info:

Redirect URI : http://ggrna.dbcls.jp/hs/205644_s_at
lang : en | div : | spe : hs | query_string : 205644_s_at | format : html | download :

0.000 | 0.000 | search_start;
0.086 | 0.086 | count_done; http://172.18.8.71:7700/v1/refseq/query?q=(nt:TGTGTGGAGATGGCGACTAGTGGAC)?source=Homo sapiens (human)?to=0&format=json
0.095 | 0.009 | count_done; http://172.18.8.71:7700/v1/refseq/query?q=(nt:TGGTGGCAGACATGTCCAAGGAATA)?source=Homo sapiens (human)?to=0&format=json
0.104 | 0.009 | count_done; http://172.18.8.71:7700/v1/refseq/query?q=(nt:TGGCTGTTCAGCAGAGAAACCCATG)?source=Homo sapiens (human)?to=0&format=json
0.114 | 0.010 | count_done; http://172.18.8.71:7700/v1/refseq/query?q=(nt:GTTAGAAGCCTTGGAACGAGTATAA)?source=Homo sapiens (human)?to=0&format=json
0.124 | 0.010 | count_done; http://172.18.8.71:7700/v1/refseq/query?q=(nt:GGATTTGATCCCTTTATGAACCTTG)?source=Homo sapiens (human)?to=0&format=json
0.133 | 0.010 | count_done; http://172.18.8.71:7700/v1/refseq/query?q=(nt:GATGGCGACTAGTGGACAACAGAAC)?source=Homo sapiens (human)?to=0&format=json
0.144 | 0.011 | count_done; http://172.18.8.71:7700/v1/refseq/query?q=(nt:GATCCCTTTATGAACCTTGTGATAG)?source=Homo sapiens (human)?to=0&format=json
0.155 | 0.011 | count_done; http://172.18.8.71:7700/v1/refseq/query?q=(nt:GAACCTTGTGATAGATGAATGTGTG)?source=Homo sapiens (human)?to=0&format=json
0.440 | 0.285 | count_done; http://172.18.8.71:7700/v1/refseq/query?q=(nt:CAGCAGAGAAACCCATGTCCTCTCT)?source=Homo sapiens (human)?to=0&format=json
0.452 | 0.012 | count_done; http://172.18.8.71:7700/v1/refseq/query?q=(nt:AGTATCATCATGTTAGAAGCCTTGG)?source=Homo sapiens (human)?to=0&format=json
0.463 | 0.011 | count_done; http://172.18.8.71:7700/v1/refseq/query?q=(nt:AAGGAATATTGCGGGGATTTGATCC)?source=Homo sapiens (human)?to=0&format=json
0.544 | 0.081 | search_done; http://172.18.8.71:7700/v1/refseq/query?q=(nt:TGTGTGGAGATGGCGACTAGTGGAC)%26(nt:TGGTGGCAGACATGTCCAAGGAATA)%26(nt:TGGCTGTTCAGCAGAGAAACCCATG)%26(nt:GTTAGAAGCCTTGGAACGAGTATAA)%26(nt:GGATTTGATCCCTTTATGAACCTTG)%26(nt:GATGGCGACTAGTGGACAACAGAAC)%26(nt:GATCCCTTTATGAACCTTGTGATAG)%26(nt:GAACCTTGTGATAGATGAATGTGTG)%26(nt:CAGCAGAGAAACCCATGTCCTCTCT)%26(nt:AGTATCATCATGTTAGAAGCCTTGG)%26(nt:AAGGAATATTGCGGGGATTTGATCC)?source=Homo sapiens (human)?to=49?from=0?snippet=full_search?drilldown=source?get=accession,version,gi,length,symbol,synonym,geneid,division,source,definition&format=json
0.549 | 0.005 | cgi_end;

GGRNA ver.2 by @meso_cacase at DBCLS
This page is licensed under a Creative Commons Attribution 4.0 International License (CC BY 4.0).

If you use GGRNA in your work, please cite:
Naito Y, Bono H. (2012)
GGRNA: an ultrafast, transcript-oriented search engine for genes and transcripts.
Nucleic Acids Res., 40, W592-W596. [Full Text]