GGRNA ver.2 Help | Advanced search | Japanese    Previous release (v1)

2021-10-17 15:09:34, GGRNA : RefSeq release 207 (Jul, 2021)

Summary:

Results:

Matches are highlighted with green background. Overlapping matches are dark colored.

PREDICTED: Homo sapiens dachshund family transcription factor 1 (DACH1), transcript variant X5, mRNA. (4118 bp)
tgggcatggacaaccactgcctccaggttttccatctccttttctgtttcctgatggactgtcttccatcgagactcttctgactaacatacaggggctgttgaaagttgccatagataatgccagagctcaagagaaacaggtccaactggaaaaaactgagctgaagatggattttttaagggaaagagaactaagggaaacacttgagaagcagttggctatggaacaaaagaatagagccatagttcaaaagaggctaaagaaggagaagaaggcaaagagaaaattgcaggaagcacttgagtttgagacgaaacggcgtgaacaagcagaacagacgctaaaacaggcagcttcaacagatagtctcagggtcttaaatgactctctgaccccagagatagaggctgaccgcagtggcggcagaacagatgctgaaaggacaatacaagatggaagactgtatttgaaaactactgtcatgtactgaatctttcctgttgaagaaatccatgttatagaaaagaactttgcagtcagacattcgtcatgggaaagttcagaaaaaaataaagtccttttaagggaacttcctga...
position 984 998 1009 1043 1250 1286 1305 1320 1346 1418 1465
Synonym: DACH
XM_011534942.3 - Homo sapiens (human) - NCBI - UCSC - RefEx(expression)
PREDICTED: Homo sapiens dachshund family transcription factor 1 (DACH1), transcript variant X3, mRNA. (4259 bp)
tgggcatggacaaccactgcctccaggttttccatctccttttctgtttcctgatggactgtcttccatcgagactcttctgactaacatacaggggctgttgaaagttgccatagataatgccagagctcaagagaaacaggtccaactggaaaaaactgagctgaagatggattttttaagggaaagagaactaagggaaacacttgagaagcagttggctatggaacaaaagaatagagccatagttcaaaagaggctaaagaaggagaagaaggcaaagagaaaattgcaggaagcacttgagtttgagacgaaacggcgtgaacaagcagaacagacgctaaaacaggcagcttcaacagatagtctcagggtcttaaatgactctctgaccccagagatagaggctgaccgcagtggcggcagaacagatgctgaaaggacaatacaagatggaagactgtatttgaaaactactgtcatgtactgaatctttcctgttgaagaaatccatgttatagaaaagaactttgcagtcagacattcgtcatgggaaagttcagaaaaaaataaagtccttttaagggaacttcctga...
position 1125 1139 1150 1184 1391 1427 1446 1461 1487 1559 1606
Synonym: DACH
XM_017020396.1 - Homo sapiens (human) - NCBI - UCSC - RefEx(expression)
Homo sapiens dachshund family transcription factor 1 (DACH1), transcript variant 3, mRNA. (4639 bp)
tgggcatggacaaccactgcctccaggttttccatctccttttctgtttcctgatggactgtcttccatcgagactcttctgactaacatacaggggctgttgaaagttgccatagataatgccagagctcaagagaaacaggtccaactggaaaaaactgagctgaagatggattttttaagggaaagagaactaagggaaacacttgagaagcagttggctatggaacaaaagaatagagccatagttcaaaagaggctaaagaaggagaagaaggcaaagagaaaattgcaggaagcacttgagtttgagacgaaacggcgtgaacaagcagaacagacgctaaaacaggcagcttcaacagatagtctcagggtcttaaatgactctctgaccccagagatagaggctgaccgcagtggcggcagaacagatgctgaaaggacaatacaagatggaagactgtatttgaaaactactgtcatgtactgaatctttcctgttgaagaaatccatgttatagaaaagaactttgcagtcagacattcgtcatgggaaagttcagaaaaaaataaagtccttttaagggaacttcctga...
position 1505 1519 1530 1564 1771 1807 1826 1841 1867 1939 1986
Synonym: DACH
NM_004392.7 - Homo sapiens (human) - NCBI - UCSC - RefEx(expression)
Homo sapiens dachshund family transcription factor 1 (DACH1), transcript variant 2, mRNA. (4801 bp)
tgggcatggacaaccactgcctccaggttttccatctccttttctgtttcctgatggactgtcttccatcgagactcttctgactaacatacaggggctgttgaaagttgccatagataatgccagagctcaagagaaacaggtccaactggaaaaaactgagctgaagatggattttttaagggaaagagaactaagggaaacacttgagaagcagttggctatggaacaaaagaatagagccatagttcaaaagaggctaaagaaggagaagaaggcaaagagaaaattgcaggaagcacttgagtttgagacgaaacggcgtgaacaagcagaacagacgctaaaacaggcagcttcaacagatagtctcagggtcttaaatgactctctgaccccagagatagaggctgaccgcagtggcggcagaacagatgctgaaaggacaatacaagatggaagactgtatttgaaaactactgtcatgtactgaatctttcctgttgaagaaatccatgttatagaaaagaactttgcagtcagacattcgtcatgggaaagttcagaaaaaaataaagtccttttaagggaacttcctga...
position 1667 1681 1692 1726 1933 1969 1988 2003 2029 2101 2148
Synonym: DACH
NM_080760.6 - Homo sapiens (human) - NCBI - UCSC - RefEx(expression)
Homo sapiens dachshund family transcription factor 1 (DACH1), transcript variant 1, mRNA. (5245 bp)
tgggcatggacaaccactgcctccaggttttccatctccttttctgtttcctgatggactgtcttccatcgagactcttctgactaacatacaggggctgttgaaagttgccatagataatgccagagctcaagagaaacaggtccaactggaaaaaactgagctgaagatggattttttaagggaaagagaactaagggaaacacttgagaagcagttggctatggaacaaaagaatagagccatagttcaaaagaggctaaagaaggagaagaaggcaaagagaaaattgcaggaagcacttgagtttgagacgaaacggcgtgaacaagcagaacagacgctaaaacaggcagcttcaacagatagtctcagggtcttaaatgactctctgaccccagagatagaggctgaccgcagtggcggcagaacagatgctgaaaggacaatacaagatggaagactgtatttgaaaactactgtcatgtactgaatctttcctgttgaagaaatccatgttatagaaaagaactttgcagtcagacattcgtcatgggaaagttcagaaaaaaataaagtccttttaagggaacttcctga...
position 2111 2125 2136 2170 2377 2413 2432 2447 2473 2545 2592
Synonym: DACH
NM_080759.6 - Homo sapiens (human) - NCBI - UCSC - RefEx(expression)
Homo sapiens dachshund family transcription factor 1 (DACH1), transcript variant 4, mRNA. (5401 bp)
tgggcatggacaaccactgcctccaggttttccatctccttttctgtttcctgatggactgtcttccatcgagactcttctgactaacatacaggggctgttgaaagttgccatagataatgccagagctcaagagaaacaggtccaactggaaaaaactgagctgaagatggattttttaagggaaagagaactaagggaaacacttgagaagcagttggctatggaacaaaagaatagagccatagttcaaaagaggctaaagaaggagaagaaggcaaagagaaaattgcaggaagcacttgagtttgagacgaaacggcgtgaacaagcagaacagacgctaaaacaggcagcttcaacagatagtctcagggtcttaaatgactctctgaccccagagatagaggctgaccgcagtggcggcagaacagatgctgaaaggacaatacaagatggaagactgtatttgaaaactactgtcatgtactgaatctttcctgttgaagaaatccatgttatagaaaagaactttgcagtcagacattcgtcatgggaaagttcagaaaaaaataaagtccttttaagggaacttcctga...
position 2267 2281 2292 2326 2533 2569 2588 2603 2629 2701 2748
Synonym: DACH
NM_001366712.1 - Homo sapiens (human) - NCBI - UCSC - RefEx(expression)

Data Export:

Maximum 10000 results can be retrieved as Tab-delimited text or JSON format.

Debug Info:

Redirect URI : http://ggrna.dbcls.jp/hs/205471_s_at
lang : en | div : | spe : hs | query_string : 205471_s_at | format : html | download :

0.000 | 0.000 | search_start;
0.095 | 0.095 | count_done; http://172.18.8.71:7700/v1/refseq/query?q=(nt:TTCCTGATGGACTGTCTTCCATCGA)?source=Homo sapiens (human)?to=0&format=json
0.112 | 0.016 | count_done; http://172.18.8.71:7700/v1/refseq/query?q=(nt:TCTTCCATCGAGACTCTTCTGACTA)?source=Homo sapiens (human)?to=0&format=json
0.124 | 0.012 | count_done; http://172.18.8.71:7700/v1/refseq/query?q=(nt:GTTGCCATAGATAATGCCAGAGCTC)?source=Homo sapiens (human)?to=0&format=json
0.137 | 0.013 | count_done; http://172.18.8.71:7700/v1/refseq/query?q=(nt:GTCTCAGGGTCTTAAATGACTCTCT)?source=Homo sapiens (human)?to=0&format=json
0.149 | 0.012 | count_done; http://172.18.8.71:7700/v1/refseq/query?q=(nt:GTCATGTACTGAATCTTTCCTGTTG)?source=Homo sapiens (human)?to=0&format=json
0.160 | 0.011 | count_done; http://172.18.8.71:7700/v1/refseq/query?q=(nt:GCTGACCGCAGTGGCGGCAGAACAG)?source=Homo sapiens (human)?to=0&format=json
0.174 | 0.014 | count_done; http://172.18.8.71:7700/v1/refseq/query?q=(nt:GACTCTTCTGACTAACATACAGGGG)?source=Homo sapiens (human)?to=0&format=json
0.186 | 0.012 | count_done; http://172.18.8.71:7700/v1/refseq/query?q=(nt:GAACTTTGCAGTCAGACATTCGTCA)?source=Homo sapiens (human)?to=0&format=json
0.198 | 0.012 | count_done; http://172.18.8.71:7700/v1/refseq/query?q=(nt:CAGGCAGCTTCAACAGATAGTCTCA)?source=Homo sapiens (human)?to=0&format=json
0.210 | 0.012 | count_done; http://172.18.8.71:7700/v1/refseq/query?q=(nt:ATGACTCTCTGACCCCAGAGATAGA)?source=Homo sapiens (human)?to=0&format=json
0.221 | 0.011 | count_done; http://172.18.8.71:7700/v1/refseq/query?q=(nt:ACGAAACGGCGTGAACAAGCAGAAC)?source=Homo sapiens (human)?to=0&format=json
0.720 | 0.499 | search_done; http://172.18.8.71:7700/v1/refseq/query?q=(nt:TTCCTGATGGACTGTCTTCCATCGA)%26(nt:TCTTCCATCGAGACTCTTCTGACTA)%26(nt:GTTGCCATAGATAATGCCAGAGCTC)%26(nt:GTCTCAGGGTCTTAAATGACTCTCT)%26(nt:GTCATGTACTGAATCTTTCCTGTTG)%26(nt:GCTGACCGCAGTGGCGGCAGAACAG)%26(nt:GACTCTTCTGACTAACATACAGGGG)%26(nt:GAACTTTGCAGTCAGACATTCGTCA)%26(nt:CAGGCAGCTTCAACAGATAGTCTCA)%26(nt:ATGACTCTCTGACCCCAGAGATAGA)%26(nt:ACGAAACGGCGTGAACAAGCAGAAC)?source=Homo sapiens (human)?to=49?from=0?snippet=full_search?drilldown=source?get=accession,version,gi,length,symbol,synonym,geneid,division,source,definition&format=json
0.724 | 0.004 | cgi_end;

GGRNA ver.2 by @meso_cacase at DBCLS
This page is licensed under a Creative Commons Attribution 4.0 International License (CC BY 4.0).

If you use GGRNA in your work, please cite:
Naito Y, Bono H. (2012)
GGRNA: an ultrafast, transcript-oriented search engine for genes and transcripts.
Nucleic Acids Res., 40, W592-W596. [Full Text]