GGRNA ver.2 Help | Advanced search | Japanese    Previous release (v1)

2024-03-29 14:31:46, GGRNA : RefSeq release 222 (Jan, 2024)

Summary:

Results:

Matches are highlighted with green background. Overlapping matches are dark colored.

Homo sapiens orosomucoid 2 (ORM2), mRNA. (759 bp)
and expression of the genes coding for human alpha 1-acid glycoprotein JOURNAL EMBO J 6 (8), 2289-2296 (1987) PUBMED 2822385 agcactgcctggctccacgtgcctcctggtctcagtatggcgctgtcctgggttcttacagtcctgagcctcctacctctgctggaagcccagatcccattgtgtgccaacctagtaccggtgcccatcaccaacgccaccctggaccggatcactggcaagtggttttatatcgcatcggcctttcgaaacgaggagtacaataagtcggttcaggagatccaagcaaccttcttttactttacccccaacaagacagaggacacgatctttctcagagagtaccagacccgccagaaccagtgcttctataactccagttacctgaatgtccagcgggagaatgggaccgtctccagatacgagggaggccgagaacatgttgctcacctgctgttccttagggacaccaagaccttgatgtttggttcctacctggacgatgagaagaactgggggctgtctttctatgctg...
position 161
Synonym: AGP-B; AGP-B'; AGP2
NM_000608.4 - Homo sapiens (human) - NCBI - UCSC - RefEx(expression)
Homo sapiens orosomucoid 1 (ORM1), mRNA. (764 bp)
homology with other human acute phase protein genes JOURNAL Nucleic Acids Res 13 (11), 3941-3952 (1985) PUBMED 2409529 agcactgcctggctccacgtgcctcctggtctcagtatggcgctgtcctgggttcttacagtcctgagcctcctacctctgctggaagcccagatcccattgtgtgccaacctagtaccggtgcccatcaccaacgccaccctggaccggatcactggcaagtggttttatatcgcatcggcctttcgaaacgaggagtacaataagtcggttcaggagatccaagcaaccttcttttacttcacccccaacaagacagaggacacgatctttctcagagagtaccagacccgacaggaccagtgcatctataacaccacctacctgaatgtccagcgggaaaatgggaccatctccagatacgtgggaggccaagagcatttcgctcacttgctgatcctcagggacaccaagacctacatgcttgcttttgacgtgaacgatgagaagaactgggggctgtctgtctatgctgacaagc...
position 161
Synonym: A1AG1; AGP-A; AGP1; HEL-S-153w; ORM
NM_000607.4 - Homo sapiens (human) - NCBI - UCSC - RefEx(expression)

Data Export:

Maximum 10000 results can be retrieved as Tab-delimited text or JSON format.

Debug Info:

Redirect URI : http://ggrna.dbcls.jp/hs/seq%3aAGTGGTTTTATATCGCATCGGCCTT
lang : en | div : | spe : hs | query_string : seq:AGTGGTTTTATATCGCATCGGCCTT | format : html | download :

0.000 | 0.000 | search_start;
0.090 | 0.089 | count_done; http://172.18.8.71:7700/v1/refsub/query?q=(nt:AGTGGTTTTATATCGCATCGGCCTT)?source=Homo sapiens (human)?to=0&format=json
0.116 | 0.026 | search_done; http://172.18.8.71:7700/v1/refsub/query?q=(nt:AGTGGTTTTATATCGCATCGGCCTT)?source=Homo sapiens (human)?to=49?from=0?snippet=full_search?drilldown=source?get=accession,version,gi,length,symbol,synonym,geneid,division,source,definition&format=json
0.116 | 0.000 | cgi_end;

GGRNA ver.2 by @meso_cacase at DBCLS
This page is licensed under a Creative Commons Attribution 4.0 International License (CC BY 4.0).

If you use GGRNA in your work, please cite:
Naito Y, Bono H. (2012)
GGRNA: an ultrafast, transcript-oriented search engine for genes and transcripts.
Nucleic Acids Res., 40, W592-W596. [Full Text]