GGRNA ver.2 Help | Advanced search | Japanese    Previous release (v1)

2021-01-24 06:08:10, GGRNA : RefSeq release 203 (Nov, 2020)

Summary:

Results:

Matches are highlighted with green background. Overlapping matches are dark colored.

Homo sapiens eukaryotic translation elongation factor 1 alpha 1 (EEF1A1), mRNA. (3512 bp)
atggtggtcacctttgctccagtcaacgttacaacggaagtaaaatctgtcgaaatgcaccatgaagctttgagtgaagctcttcctggggacaatgtgggcttcaatgtcaagaatgtgtctgtcaaggatgttcgtcgtggcaacgttgctggtgacagcaaaaatgacccaccaatggaagcagctggcttcactgctcaggtgattatcctgaaccatccaggccaaataagcgccggctatgcccctgtattggattgccacacggctcacattgcatgcaagtttgctgagctgaaggaaaagattgatcgccgttctggtaaaaagctggaagatggccctaaattcttgaagtctggtgatgctgccattgttgatatggttcctggcaagcccatgtgtgttgagagcttctcagactatccacctttgggtcgctttgctgttcgtgatatgagacagacagttgcggtgggtgtcatcaaagcagtggacaagaaggctgctggagctggcaaggtcaccaagtctgcccagaaagctcagaaggctaaatgaatattatccctaatacctgccaccccactcttaatc...
position 962 1008 1067 1113 1131 1154 1245 1270 1327 1392 1407
Synonym: CCS-3; CCS3; EE1A1; EEF-1; EEF1A; eEF1A-1; EF-Tu; EF1A; GRAF-1EF; LENG7; PTI1
NM_001402.6 - Homo sapiens (human) - NCBI - UCSC - RefEx(expression)

Data Export:

Maximum 10000 results can be retrieved as Tab-delimited text or JSON format.

Debug Info:

Redirect URI : http://ggrna.dbcls.jp/hs/204892_x_at
lang : en | div : | spe : hs | query_string : 204892_x_at | format : html | download :

0.000 | 0.000 | search_start;
0.100 | 0.100 | count_done; http://172.18.8.71:7700/v1/refseq/query?q=(nt:TGGCAAGGTCACCAAGTCTGCCCAG)?source=Homo sapiens (human)?to=0&format=json
0.112 | 0.012 | count_done; http://172.18.8.71:7700/v1/refseq/query?q=(nt:TGGAAGCAGCTGGCTTCACTGCTCA)?source=Homo sapiens (human)?to=0&format=json
0.124 | 0.012 | count_done; http://172.18.8.71:7700/v1/refseq/query?q=(nt:GTGAAGCTCTTCCTGGGGACAATGT)?source=Homo sapiens (human)?to=0&format=json
0.136 | 0.011 | count_done; http://172.18.8.71:7700/v1/refseq/query?q=(nt:GTCTGTCAAGGATGTTCGTCGTGGC)?source=Homo sapiens (human)?to=0&format=json
0.145 | 0.009 | count_done; http://172.18.8.71:7700/v1/refseq/query?q=(nt:GGTCGCTTTGCTGTTCGTGATATGA)?source=Homo sapiens (human)?to=0&format=json
0.156 | 0.011 | count_done; http://172.18.8.71:7700/v1/refseq/query?q=(nt:GATATGGTTCCTGGCAAGCCCATGT)?source=Homo sapiens (human)?to=0&format=json
0.167 | 0.011 | count_done; http://172.18.8.71:7700/v1/refseq/query?q=(nt:GAAGTCTGGTGATGCTGCCATTGTT)?source=Homo sapiens (human)?to=0&format=json
0.178 | 0.011 | count_done; http://172.18.8.71:7700/v1/refseq/query?q=(nt:GAAGGCTGCTGGAGCTGGCAAGGTC)?source=Homo sapiens (human)?to=0&format=json
0.191 | 0.013 | count_done; http://172.18.8.71:7700/v1/refseq/query?q=(nt:CTATGCCCCTGTATTGGATTGCCAC)?source=Homo sapiens (human)?to=0&format=json
0.202 | 0.011 | count_done; http://172.18.8.71:7700/v1/refseq/query?q=(nt:AGGCCAAATAAGCGCCGGCTATGCC)?source=Homo sapiens (human)?to=0&format=json
0.214 | 0.011 | count_done; http://172.18.8.71:7700/v1/refseq/query?q=(nt:ACACGGCTCACATTGCATGCAAGTT)?source=Homo sapiens (human)?to=0&format=json
0.259 | 0.046 | search_done; http://172.18.8.71:7700/v1/refseq/query?q=(nt:TGGCAAGGTCACCAAGTCTGCCCAG)%26(nt:TGGAAGCAGCTGGCTTCACTGCTCA)%26(nt:GTGAAGCTCTTCCTGGGGACAATGT)%26(nt:GTCTGTCAAGGATGTTCGTCGTGGC)%26(nt:GGTCGCTTTGCTGTTCGTGATATGA)%26(nt:GATATGGTTCCTGGCAAGCCCATGT)%26(nt:GAAGTCTGGTGATGCTGCCATTGTT)%26(nt:GAAGGCTGCTGGAGCTGGCAAGGTC)%26(nt:CTATGCCCCTGTATTGGATTGCCAC)%26(nt:AGGCCAAATAAGCGCCGGCTATGCC)%26(nt:ACACGGCTCACATTGCATGCAAGTT)?source=Homo sapiens (human)?to=49?from=0?snippet=full_search?drilldown=source?get=accession,version,gi,length,symbol,synonym,geneid,division,source,definition&format=json
0.260 | 0.001 | cgi_end;

GGRNA ver.2 by @meso_cacase at DBCLS
This page is licensed under a Creative Commons Attribution 4.0 International License (CC BY 4.0).

If you use GGRNA in your work, please cite:
Naito Y, Bono H. (2012)
GGRNA: an ultrafast, transcript-oriented search engine for genes and transcripts.
Nucleic Acids Res., 40, W592-W596. [Full Text]