GGRNA ver.2 Help | Advanced search | Japanese    Previous release (v1)

2021-01-24 05:39:36, GGRNA : RefSeq release 203 (Nov, 2020)

Summary:

Results:

Matches are highlighted with green background. Overlapping matches are dark colored.

PREDICTED: Homo sapiens polo like kinase 4 (PLK4), transcript variant X3, mRNA. (3588 bp)
aatccgactcctaattttcattgattaaaactcctttcagacatataagtttaataaataacttttttgttgactttcaagtaaagtgattttttttaatttaacataaagtcttcagaaagcctttctatgaaagaattttaacctataatgtaaaggatgtattctgagagaacaaagcagaatgaaacttgagtcacttactaaatatagtggatataaaatagaacacctgactttgctcttagaccataacccccgaacttactatgttcatatatttgtattgaacaatcttttaaaagcaaaaatgtaaatgatgtgtagtttatttgtgcttttattgttttccctgcgtctcagacatgttgagaatcatggacaaaacctgctggaattttggaatttttgaagatgtaaataatgtgtatttatgttataagtaacatatgtaaacatgtatatttgttttatatttatttttgtaacaccagtgtctgatgaaacatttttgcaaatgcattttataaaaaaataaatatagtgataagttacatta
position 3131 3181 3209 3216 3252 3264 3282 3312 3377 3402 3504
Synonym: MCCRP2; SAK; STK18
XM_005262701.3 - Homo sapiens (human) - NCBI - UCSC - RefEx(expression)
Homo sapiens polo like kinase 4 (PLK4), transcript variant 3, mRNA. (3705 bp)
aatccgactcctaattttcattgattaaaactcctttcagacatataagtttaataaataacttttttgttgactttcaagtaaagtgattttttttaatttaacataaagtcttcagaaagcctttctatgaaagaattttaacctataatgtaaaggatgtattctgagagaacaaagcagaatgaaacttgagtcacttactaaatatagtggatataaaatagaacacctgactttgctcttagaccataacccccgaacttactatgttcatatatttgtattgaacaatcttttaaaagcaaaaatgtaaatgatgtgtagtttatttgtgcttttattgttttccctgcgtctcagacatgttgagaatcatggacaaaacctgctggaattttggaatttttgaagatgtaaataatgtgtatttatgttataagtaacatatgtaaacatgtatatttgttttatatttatttttgtaacaccagtgtctgatgaaacatttttgcaaatgcattttataaaaaaataaatatagtgataagttacattatcttttgattcatttaattaaatacttatttttaaataact...
position 3100 3150 3178 3185 3221 3233 3251 3281 3346 3371 3473
Synonym: MCCRP2; SAK; STK18
NM_001190801.2 - Homo sapiens (human) - NCBI - UCSC - RefEx(expression)
Homo sapiens polo like kinase 4 (PLK4), transcript variant 2, mRNA. (3742 bp)
aatccgactcctaattttcattgattaaaactcctttcagacatataagtttaataaataacttttttgttgactttcaagtaaagtgattttttttaatttaacataaagtcttcagaaagcctttctatgaaagaattttaacctataatgtaaaggatgtattctgagagaacaaagcagaatgaaacttgagtcacttactaaatatagtggatataaaatagaacacctgactttgctcttagaccataacccccgaacttactatgttcatatatttgtattgaacaatcttttaaaagcaaaaatgtaaatgatgtgtagtttatttgtgcttttattgttttccctgcgtctcagacatgttgagaatcatggacaaaacctgctggaattttggaatttttgaagatgtaaataatgtgtatttatgttataagtaacatatgtaaacatgtatatttgttttatatttatttttgtaacaccagtgtctgatgaaacatttttgcaaatgcattttataaaaaaataaatatagtgataagttacattatcttttgattcatttaattaaatacttatttttaaataact...
position 3137 3187 3215 3222 3258 3270 3288 3318 3383 3408 3510
Synonym: MCCRP2; SAK; STK18
NM_001190799.2 - Homo sapiens (human) - NCBI - UCSC - RefEx(expression)
PREDICTED: Homo sapiens polo like kinase 4 (PLK4), transcript variant X2, mRNA. (3781 bp)
aatccgactcctaattttcattgattaaaactcctttcagacatataagtttaataaataacttttttgttgactttcaagtaaagtgattttttttaatttaacataaagtcttcagaaagcctttctatgaaagaattttaacctataatgtaaaggatgtattctgagagaacaaagcagaatgaaacttgagtcacttactaaatatagtggatataaaatagaacacctgactttgctcttagaccataacccccgaacttactatgttcatatatttgtattgaacaatcttttaaaagcaaaaatgtaaatgatgtgtagtttatttgtgcttttattgttttccctgcgtctcagacatgttgagaatcatggacaaaacctgctggaattttggaatttttgaagatgtaaataatgtgtatttatgttataagtaacatatgtaaacatgtatatttgttttatatttatttttgtaacaccagtgtctgatgaaacatttttgcaaatgcattttataaaaaaataaatatagtgataagttacatta
position 3324 3374 3402 3409 3445 3457 3475 3505 3570 3595 3697
Synonym: MCCRP2; SAK; STK18
XM_017007663.2 - Homo sapiens (human) - NCBI - UCSC - RefEx(expression)
Homo sapiens polo like kinase 4 (PLK4), transcript variant 1, mRNA. (3838 bp)
aatccgactcctaattttcattgattaaaactcctttcagacatataagtttaataaataacttttttgttgactttcaagtaaagtgattttttttaatttaacataaagtcttcagaaagcctttctatgaaagaattttaacctataatgtaaaggatgtattctgagagaacaaagcagaatgaaacttgagtcacttactaaatatagtggatataaaatagaacacctgactttgctcttagaccataacccccgaacttactatgttcatatatttgtattgaacaatcttttaaaagcaaaaatgtaaatgatgtgtagtttatttgtgcttttattgttttccctgcgtctcagacatgttgagaatcatggacaaaacctgctggaattttggaatttttgaagatgtaaataatgtgtatttatgttataagtaacatatgtaaacatgtatatttgttttatatttatttttgtaacaccagtgtctgatgaaacatttttgcaaatgcattttataaaaaaataaatatagtgataagttacattatcttttgattcatttaattaaatacttatttttaaataact...
position 3233 3283 3311 3318 3354 3366 3384 3414 3479 3504 3606
Synonym: MCCRP2; SAK; STK18
NM_014264.5 - Homo sapiens (human) - NCBI - UCSC - RefEx(expression)
PREDICTED: Homo sapiens polo like kinase 4 (PLK4), transcript variant X1, mRNA. (3881 bp)
aatccgactcctaattttcattgattaaaactcctttcagacatataagtttaataaataacttttttgttgactttcaagtaaagtgattttttttaatttaacataaagtcttcagaaagcctttctatgaaagaattttaacctataatgtaaaggatgtattctgagagaacaaagcagaatgaaacttgagtcacttactaaatatagtggatataaaatagaacacctgactttgctcttagaccataacccccgaacttactatgttcatatatttgtattgaacaatcttttaaaagcaaaaatgtaaatgatgtgtagtttatttgtgcttttattgttttccctgcgtctcagacatgttgagaatcatggacaaaacctgctggaattttggaatttttgaagatgtaaataatgtgtatttatgttataagtaacatatgtaaacatgtatatttgttttatatttatttttgtaacaccagtgtctgatgaaacatttttgcaaatgcattttataaaaaaataaatatagtgataagttacatta
position 3424 3474 3502 3509 3545 3557 3575 3605 3670 3695 3797
Synonym: MCCRP2; SAK; STK18
XM_017007662.1 - Homo sapiens (human) - NCBI - UCSC - RefEx(expression)

Data Export:

Maximum 10000 results can be retrieved as Tab-delimited text or JSON format.

Debug Info:

Redirect URI : http://ggrna.dbcls.jp/hs/204886_at
lang : en | div : | spe : hs | query_string : 204886_at | format : html | download :

0.000 | 0.000 | search_start;
0.103 | 0.103 | count_done; http://172.18.8.71:7700/v1/refseq/query?q=(nt:TTTCCCTGCGTCTCAGACATGTTGA)?source=Homo sapiens (human)?to=0&format=json
0.115 | 0.012 | count_done; http://172.18.8.71:7700/v1/refseq/query?q=(nt:TGTATTGAACAATCTTTTAAAAGCA)?source=Homo sapiens (human)?to=0&format=json
0.126 | 0.011 | count_done; http://172.18.8.71:7700/v1/refseq/query?q=(nt:TGTAAAGGATGTATTCTGAGAGAAC)?source=Homo sapiens (human)?to=0&format=json
0.137 | 0.011 | count_done; http://172.18.8.71:7700/v1/refseq/query?q=(nt:TAACCCCCGAACTTACTATGTTCAT)?source=Homo sapiens (human)?to=0&format=json
0.148 | 0.011 | count_done; http://172.18.8.71:7700/v1/refseq/query?q=(nt:TAACATAAAGTCTTCAGAAAGCCTT)?source=Homo sapiens (human)?to=0&format=json
0.159 | 0.011 | count_done; http://172.18.8.71:7700/v1/refseq/query?q=(nt:GCAGAATGAAACTTGAGTCACTTAC)?source=Homo sapiens (human)?to=0&format=json
0.170 | 0.011 | count_done; http://172.18.8.71:7700/v1/refseq/query?q=(nt:GACTTTGCTCTTAGACCATAACCCC)?source=Homo sapiens (human)?to=0&format=json
0.181 | 0.011 | count_done; http://172.18.8.71:7700/v1/refseq/query?q=(nt:GAATCATGGACAAAACCTGCTGGAA)?source=Homo sapiens (human)?to=0&format=json
0.192 | 0.011 | count_done; http://172.18.8.71:7700/v1/refseq/query?q=(nt:GAAACTTGAGTCACTTACTAAATAT)?source=Homo sapiens (human)?to=0&format=json
0.203 | 0.011 | count_done; http://172.18.8.71:7700/v1/refseq/query?q=(nt:ATTTATTTTTGTAACACCAGTGTCT)?source=Homo sapiens (human)?to=0&format=json
0.215 | 0.012 | count_done; http://172.18.8.71:7700/v1/refseq/query?q=(nt:AATAGAACACCTGACTTTGCTCTTA)?source=Homo sapiens (human)?to=0&format=json
0.361 | 0.146 | search_done; http://172.18.8.71:7700/v1/refseq/query?q=(nt:TTTCCCTGCGTCTCAGACATGTTGA)%26(nt:TGTATTGAACAATCTTTTAAAAGCA)%26(nt:TGTAAAGGATGTATTCTGAGAGAAC)%26(nt:TAACCCCCGAACTTACTATGTTCAT)%26(nt:TAACATAAAGTCTTCAGAAAGCCTT)%26(nt:GCAGAATGAAACTTGAGTCACTTAC)%26(nt:GACTTTGCTCTTAGACCATAACCCC)%26(nt:GAATCATGGACAAAACCTGCTGGAA)%26(nt:GAAACTTGAGTCACTTACTAAATAT)%26(nt:ATTTATTTTTGTAACACCAGTGTCT)%26(nt:AATAGAACACCTGACTTTGCTCTTA)?source=Homo sapiens (human)?to=49?from=0?snippet=full_search?drilldown=source?get=accession,version,gi,length,symbol,synonym,geneid,division,source,definition&format=json
0.365 | 0.004 | cgi_end;

GGRNA ver.2 by @meso_cacase at DBCLS
This page is licensed under a Creative Commons Attribution 4.0 International License (CC BY 4.0).

If you use GGRNA in your work, please cite:
Naito Y, Bono H. (2012)
GGRNA: an ultrafast, transcript-oriented search engine for genes and transcripts.
Nucleic Acids Res., 40, W592-W596. [Full Text]