GGRNA ver.2 Help | Advanced search | Japanese    Previous release (v1)

2021-01-17 00:10:03, GGRNA : RefSeq release 203 (Nov, 2020)

Summary:

Results:

Matches are highlighted with green background. Overlapping matches are dark colored.

Homo sapiens SH3 and SYLF domain containing 1 (SH3YL1), transcript variant 2, mRNA. (1687 bp)
cttctgttctacaaaatttccattccgtatgtaaaagattttgtttttctatataaaaagagctgactgacatatctttaaatactttgtactaactttatcacacttactgtgtcatagaatatcatacagtttatacgctcatagttctcttgtgaacacttcaaacatcgctaagcatttgatctggccatgtatatggtagctgtgttttaatttgagaatcttgagggtagagccacaaatttcaattcttacatttccatttgcaaagtgactagagaaaaagaaatcagcttaaatgaggtattaagtaatgtttagagtcgtaggtattaactagaatataaatccttagaaattgtctttataccttcaaaaattatactatgcatttatcatagaaatgtgattacaaagaagtctgactaccatgtctttaaacatatggcatctctcaacttttcttccttatggggctacatttgttcatttccagcagtagcataaacttacggtgacatggtagacttgtctctaaataaaatttttaaatgtttactaagttaa
position 1177 1211 1249 1274 1289 1347 1536 1562 1578 1594 1634
Synonym: RAY
NM_001159597.3 - Homo sapiens (human) - NCBI - UCSC - RefEx(expression)
Homo sapiens SH3 and SYLF domain containing 1 (SH3YL1), transcript variant 1, mRNA. (1744 bp)
cttctgttctacaaaatttccattccgtatgtaaaagattttgtttttctatataaaaagagctgactgacatatctttaaatactttgtactaactttatcacacttactgtgtcatagaatatcatacagtttatacgctcatagttctcttgtgaacacttcaaacatcgctaagcatttgatctggccatgtatatggtagctgtgttttaatttgagaatcttgagggtagagccacaaatttcaattcttacatttccatttgcaaagtgactagagaaaaagaaatcagcttaaatgaggtattaagtaatgtttagagtcgtaggtattaactagaatataaatccttagaaattgtctttataccttcaaaaattatactatgcatttatcatagaaatgtgattacaaagaagtctgactaccatgtctttaaacatatggcatctctcaacttttcttccttatggggctacatttgttcatttccagcagtagcataaacttacggtgacatggtagacttgtctctaaataaaatttttaaatgtttactaagttaa
position 1234 1268 1306 1331 1346 1404 1593 1619 1635 1651 1691
Synonym: RAY
NM_015677.4 - Homo sapiens (human) - NCBI - UCSC - RefEx(expression)
Homo sapiens SH3 and SYLF domain containing 1 (SH3YL1), transcript variant 3, mRNA. (1815 bp)
cttctgttctacaaaatttccattccgtatgtaaaagattttgtttttctatataaaaagagctgactgacatatctttaaatactttgtactaactttatcacacttactgtgtcatagaatatcatacagtttatacgctcatagttctcttgtgaacacttcaaacatcgctaagcatttgatctggccatgtatatggtagctgtgttttaatttgagaatcttgagggtagagccacaaatttcaattcttacatttccatttgcaaagtgactagagaaaaagaaatcagcttaaatgaggtattaagtaatgtttagagtcgtaggtattaactagaatataaatccttagaaattgtctttataccttcaaaaattatactatgcatttatcatagaaatgtgattacaaagaagtctgactaccatgtctttaaacatatggcatctctcaacttttcttccttatggggctacatttgttcatttccagcagtagcataaacttacggtgacatggtagacttgtctctaaataaaatttttaaatgtttactaagttaa
position 1305 1339 1377 1402 1417 1475 1664 1690 1706 1722 1762
Synonym: RAY
NM_001282682.2 - Homo sapiens (human) - NCBI - UCSC - RefEx(expression)
Homo sapiens SH3 and SYLF domain containing 1 (SH3YL1), transcript variant 4, mRNA. (1963 bp)
cttctgttctacaaaatttccattccgtatgtaaaagattttgtttttctatataaaaagagctgactgacatatctttaaatactttgtactaactttatcacacttactgtgtcatagaatatcatacagtttatacgctcatagttctcttgtgaacacttcaaacatcgctaagcatttgatctggccatgtatatggtagctgtgttttaatttgagaatcttgagggtagagccacaaatttcaattcttacatttccatttgcaaagtgactagagaaaaagaaatcagcttaaatgaggtattaagtaatgtttagagtcgtaggtattaactagaatataaatccttagaaattgtctttataccttcaaaaattatactatgcatttatcatagaaatgtgattacaaagaagtctgactaccatgtctttaaacatatggcatctctcaacttttcttccttatggggctacatttgttcatttccagcagtagcataaacttacggtgacatggtagacttgtctctaaataaaatttttaaatgtttactaagttaa
position 1453 1487 1525 1550 1565 1623 1812 1838 1854 1870 1910
Synonym: RAY
NM_001282687.2 - Homo sapiens (human) - NCBI - UCSC - RefEx(expression)
Homo sapiens SH3 and SYLF domain containing 1 (SH3YL1), transcript variant 7, non-coding RNA. (2025 bp)
cttctgttctacaaaatttccattccgtatgtaaaagattttgtttttctatataaaaagagctgactgacatatctttaaatactttgtactaactttatcacacttactgtgtcatagaatatcatacagtttatacgctcatagttctcttgtgaacacttcaaacatcgctaagcatttgatctggccatgtatatggtagctgtgttttaatttgagaatcttgagggtagagccacaaatttcaattcttacatttccatttgcaaagtgactagagaaaaagaaatcagcttaaatgaggtattaagtaatgtttagagtcgtaggtattaactagaatataaatccttagaaattgtctttataccttcaaaaattatactatgcatttatcatagaaatgtgattacaaagaagtctgactaccatgtctttaaacatatggcatctctcaacttttcttccttatggggctacatttgttcatttccagcagtagcataaacttacggtgacatggtagacttgtctctaaataaaatttttaaatgtttactaagttaatatttcaaaaaaaaaaaaaaaaaaa
position 1490 1524 1562 1587 1602 1660 1849 1875 1891 1907 1947
Synonym: RAY
NR_104225.1 - Homo sapiens (human) - NCBI - UCSC - RefEx(expression)
Homo sapiens SH3 and SYLF domain containing 1 (SH3YL1), transcript variant 8, non-coding RNA. (2497 bp)
cttctgttctacaaaatttccattccgtatgtaaaagattttgtttttctatataaaaagagctgactgacatatctttaaatactttgtactaactttatcacacttactgtgtcatagaatatcatacagtttatacgctcatagttctcttgtgaacacttcaaacatcgctaagcatttgatctggccatgtatatggtagctgtgttttaatttgagaatcttgagggtagagccacaaatttcaattcttacatttccatttgcaaagtgactagagaaaaagaaatcagcttaaatgaggtattaagtaatgtttagagtcgtaggtattaactagaatataaatccttagaaattgtctttataccttcaaaaattatactatgcatttatcatagaaatgtgattacaaagaagtctgactaccatgtctttaaacatatggcatctctcaacttttcttccttatggggctacatttgttcatttccagcagtagcataaacttacggtgacatggtagacttgtctctaaataaaatttttaaatgtttactaagttaatatttcaaaaaaaaaaaaaaaaaaa
position 1962 1996 2034 2059 2074 2132 2321 2347 2363 2379 2419
Synonym: RAY
NR_104226.1 - Homo sapiens (human) - NCBI - UCSC - RefEx(expression)
Homo sapiens SH3 and SYLF domain containing 1 (SH3YL1), transcript variant 9, non-coding RNA. (3319 bp)
cttctgttctacaaaatttccattccgtatgtaaaagattttgtttttctatataaaaagagctgactgacatatctttaaatactttgtactaactttatcacacttactgtgtcatagaatatcatacagtttatacgctcatagttctcttgtgaacacttcaaacatcgctaagcatttgatctggccatgtatatggtagctgtgttttaatttgagaatcttgagggtagagccacaaatttcaattcttacatttccatttgcaaagtgactagagaaaaagaaatcagcttaaatgaggtattaagtaatgtttagagtcgtaggtattaactagaatataaatccttagaaattgtctttataccttcaaaaattatactatgcatttatcatagaaatgtgattacaaagaagtctgactaccatgtctttaaacatatggcatctctcaacttttcttccttatggggctacatttgttcatttccagcagtagcataaacttacggtgacatggtagacttgtctctaaataaaatttttaaatgtttactaagttaatatttcaaaaaaaaaaaaaaaaaaa
position 2784 2818 2856 2881 2896 2954 3143 3169 3185 3201 3241
Synonym: RAY
NR_104227.1 - Homo sapiens (human) - NCBI - UCSC - RefEx(expression)
Homo sapiens SH3 and SYLF domain containing 1 (SH3YL1), transcript variant 5, non-coding RNA. (3368 bp)
cttctgttctacaaaatttccattccgtatgtaaaagattttgtttttctatataaaaagagctgactgacatatctttaaatactttgtactaactttatcacacttactgtgtcatagaatatcatacagtttatacgctcatagttctcttgtgaacacttcaaacatcgctaagcatttgatctggccatgtatatggtagctgtgttttaatttgagaatcttgagggtagagccacaaatttcaattcttacatttccatttgcaaagtgactagagaaaaagaaatcagcttaaatgaggtattaagtaatgtttagagtcgtaggtattaactagaatataaatccttagaaattgtctttataccttcaaaaattatactatgcatttatcatagaaatgtgattacaaagaagtctgactaccatgtctttaaacatatggcatctctcaacttttcttccttatggggctacatttgttcatttccagcagtagcataaacttacggtgacatggtagacttgtctctaaataaaatttttaaatgtttactaagttaa
position 2858 2892 2930 2955 2970 3028 3217 3243 3259 3275 3315
Synonym: RAY
NR_104223.2 - Homo sapiens (human) - NCBI - UCSC - RefEx(expression)

Data Export:

Maximum 10000 results can be retrieved as Tab-delimited text or JSON format.

Debug Info:

Redirect URI : http://ggrna.dbcls.jp/hs/204019_s_at
lang : en | div : | spe : hs | query_string : 204019_s_at | format : html | download :

0.000 | 0.000 | search_start;
0.087 | 0.087 | count_done; http://172.18.8.71:7700/v1/refseq/query?q=(nt:GTTTATACGCTCATAGTTCTCTTGT)?source=Homo sapiens (human)?to=0&format=json
0.101 | 0.014 | count_done; http://172.18.8.71:7700/v1/refseq/query?q=(nt:GGTGACATGGTAGACTTGTCTCTAA)?source=Homo sapiens (human)?to=0&format=json
0.111 | 0.010 | count_done; http://172.18.8.71:7700/v1/refseq/query?q=(nt:GGGCTACATTTGTTCATTTCCAGCA)?source=Homo sapiens (human)?to=0&format=json
0.123 | 0.012 | count_done; http://172.18.8.71:7700/v1/refseq/query?q=(nt:GAGCTGACTGACATATCTTTAAATA)?source=Homo sapiens (human)?to=0&format=json
0.134 | 0.011 | count_done; http://172.18.8.71:7700/v1/refseq/query?q=(nt:GAACACTTCAAACATCGCTAAGCAT)?source=Homo sapiens (human)?to=0&format=json
0.145 | 0.011 | count_done; http://172.18.8.71:7700/v1/refseq/query?q=(nt:CGCTAAGCATTTGATCTGGCCATGT)?source=Homo sapiens (human)?to=0&format=json
0.155 | 0.010 | count_done; http://172.18.8.71:7700/v1/refseq/query?q=(nt:CATATGGCATCTCTCAACTTTTCTT)?source=Homo sapiens (human)?to=0&format=json
0.165 | 0.010 | count_done; http://172.18.8.71:7700/v1/refseq/query?q=(nt:AGGGTAGAGCCACAAATTTCAATTC)?source=Homo sapiens (human)?to=0&format=json
0.175 | 0.010 | count_done; http://172.18.8.71:7700/v1/refseq/query?q=(nt:AGAAGTCTGACTACCATGTCTTTAA)?source=Homo sapiens (human)?to=0&format=json
0.187 | 0.011 | count_done; http://172.18.8.71:7700/v1/refseq/query?q=(nt:ACTTTTCTTCCTTATGGGGCTACAT)?source=Homo sapiens (human)?to=0&format=json
0.197 | 0.011 | count_done; http://172.18.8.71:7700/v1/refseq/query?q=(nt:AACTTTATCACACTTACTGTGTCAT)?source=Homo sapiens (human)?to=0&format=json
0.326 | 0.129 | search_done; http://172.18.8.71:7700/v1/refseq/query?q=(nt:GTTTATACGCTCATAGTTCTCTTGT)%26(nt:GGTGACATGGTAGACTTGTCTCTAA)%26(nt:GGGCTACATTTGTTCATTTCCAGCA)%26(nt:GAGCTGACTGACATATCTTTAAATA)%26(nt:GAACACTTCAAACATCGCTAAGCAT)%26(nt:CGCTAAGCATTTGATCTGGCCATGT)%26(nt:CATATGGCATCTCTCAACTTTTCTT)%26(nt:AGGGTAGAGCCACAAATTTCAATTC)%26(nt:AGAAGTCTGACTACCATGTCTTTAA)%26(nt:ACTTTTCTTCCTTATGGGGCTACAT)%26(nt:AACTTTATCACACTTACTGTGTCAT)?source=Homo sapiens (human)?to=49?from=0?snippet=full_search?drilldown=source?get=accession,version,gi,length,symbol,synonym,geneid,division,source,definition&format=json
0.331 | 0.005 | cgi_end;

GGRNA ver.2 by @meso_cacase at DBCLS
This page is licensed under a Creative Commons Attribution 4.0 International License (CC BY 4.0).

If you use GGRNA in your work, please cite:
Naito Y, Bono H. (2012)
GGRNA: an ultrafast, transcript-oriented search engine for genes and transcripts.
Nucleic Acids Res., 40, W592-W596. [Full Text]