GGRNA ver.2 Help | Advanced search | Japanese    Previous release (v1)

2024-03-29 19:26:49, GGRNA : RefSeq release 222 (Jan, 2024)

Summary:

Results:

Matches are highlighted with green background. Overlapping matches are dark colored.

Homo sapiens ribosomal protein L27a (RPL27A), mRNA. (4535 bp)
AUTHORS Frigerio JM, Dagorn JC and Iovanna JL. TITLE Cloning, sequencing and expression of the L5, L21, L27a, L28, S5, S9, S10 and S29 human ribosomal protein mRNAs JOURNAL Biochim Biophys Acta 1262 (1), 64-68 (1995) PUBMED 7772601 ctttttcgtctgggctgccaacatgccatccagactgaggaagacccggaaacttaggggccacgtgagccacggccacggccgcataggcaagcaccggaagcaccccggcggccgcggtaatgctggtggtctgcatcaccaccggatcaacttcgacaaataccacccaggctactttgggaaagttggtatgaagcattaccacttaaagaggaaccagagcttctgcccaactgtcaaccttgacaaattgtggactttggtcagtgaacagacacgggtgaatgctgctaaaaacaagactggggctgctcccatcattgatgtggtgcgatcgggctactacaa...
position 33
Synonym: L27A; uL15
NM_000990.5 - Homo sapiens (human) - NCBI - UCSC - RefEx(expression)

Data Export:

Maximum 10000 results can be retrieved as Tab-delimited text or JSON format.

Debug Info:

Redirect URI : http://ggrna.dbcls.jp/hs/seq%3aGACTGAGGAAGACCCGGAAACTTAG
lang : en | div : | spe : hs | query_string : seq:GACTGAGGAAGACCCGGAAACTTAG | format : html | download :

0.000 | 0.000 | search_start;
0.086 | 0.086 | count_done; http://172.18.8.71:7700/v1/refsub/query?q=(nt:GACTGAGGAAGACCCGGAAACTTAG)?source=Homo sapiens (human)?to=0&format=json
0.121 | 0.035 | search_done; http://172.18.8.71:7700/v1/refsub/query?q=(nt:GACTGAGGAAGACCCGGAAACTTAG)?source=Homo sapiens (human)?to=49?from=0?snippet=full_search?drilldown=source?get=accession,version,gi,length,symbol,synonym,geneid,division,source,definition&format=json
0.121 | 0.000 | cgi_end;

GGRNA ver.2 by @meso_cacase at DBCLS
This page is licensed under a Creative Commons Attribution 4.0 International License (CC BY 4.0).

If you use GGRNA in your work, please cite:
Naito Y, Bono H. (2012)
GGRNA: an ultrafast, transcript-oriented search engine for genes and transcripts.
Nucleic Acids Res., 40, W592-W596. [Full Text]