GGRNA ver.2 Help | Advanced search | Japanese    Previous release (v1)

2021-01-16 23:39:47, GGRNA : RefSeq release 203 (Nov, 2020)

Summary:

Results:

Matches are highlighted with green background. Overlapping matches are dark colored.

Homo sapiens ribosomal protein L27a (RPL27A), mRNA. (4535 bp)
L21, L27a, L28, S5, S9, S10 and S29 human ribosomal protein mRNAs JOURNAL Biochim Biophys Acta 1262 (1), 64-68 (1995) PUBMED 7772601 ctttttcgtctgggctgccaacatgccatccagactgaggaagacccggaaacttaggggccacgtgagccacggccacggccgcataggcaagcaccggaagcaccccggcggccgcggtaatgctggtggtctgcatcaccaccggatcaacttcgacaaataccacccaggctactttgggaaagttggtatgaagcattaccacttaaagaggaaccagagcttctgcccaactgtcaaccttgacaaattgtggactttggtcagtgaacagacacgggtgaatgctgctaaaaacaagactggggctgctcccatcattgatgtggtgcgatcgggctactacaaagttctgggaaagggaaagctcccaaagcagcctgtcatcgtgaaggccaaattcttcagcagaagagctgaggagaagattaagagtgttgggggggcctgtgtcctggtggctt...
position 33 115 117 140 143 145 203 228 231 270 273
Synonym: L27A
NM_000990.5 - Homo sapiens (human) - NCBI - UCSC - RefEx(expression)

Data Export:

Maximum 10000 results can be retrieved as Tab-delimited text or JSON format.

Debug Info:

Redirect URI : http://ggrna.dbcls.jp/hs/203034_s_at
lang : en | div : | spe : hs | query_string : 203034_s_at | format : html | download :

0.000 | 0.000 | search_start;
0.087 | 0.087 | count_done; http://172.18.8.71:7700/v1/refseq/query?q=(nt:TCTGCCCAACTGTCAACCTTGACAA)?source=Homo sapiens (human)?to=0&format=json
0.098 | 0.012 | count_done; http://172.18.8.71:7700/v1/refseq/query?q=(nt:TACCACTTAAAGAGGAACCAGAGCT)?source=Homo sapiens (human)?to=0&format=json
0.109 | 0.011 | count_done; http://172.18.8.71:7700/v1/refseq/query?q=(nt:GTGAACAGACACGGGTGAATGCTGC)?source=Homo sapiens (human)?to=0&format=json
0.120 | 0.011 | count_done; http://172.18.8.71:7700/v1/refseq/query?q=(nt:GCGGTAATGCTGGTGGTCTGCATCA)?source=Homo sapiens (human)?to=0&format=json
0.134 | 0.015 | count_done; http://172.18.8.71:7700/v1/refseq/query?q=(nt:GCCCAACTGTCAACCTTGACAAATT)?source=Homo sapiens (human)?to=0&format=json
0.144 | 0.010 | count_done; http://172.18.8.71:7700/v1/refseq/query?q=(nt:GACTGAGGAAGACCCGGAAACTTAG)?source=Homo sapiens (human)?to=0&format=json
0.154 | 0.010 | count_done; http://172.18.8.71:7700/v1/refseq/query?q=(nt:CCGGATCAACTTCGACAAATACCAC)?source=Homo sapiens (human)?to=0&format=json
0.165 | 0.010 | count_done; http://172.18.8.71:7700/v1/refseq/query?q=(nt:CCGCGGTAATGCTGGTGGTCTGCAT)?source=Homo sapiens (human)?to=0&format=json
0.176 | 0.011 | count_done; http://172.18.8.71:7700/v1/refseq/query?q=(nt:CACCGGATCAACTTCGACAAATACC)?source=Homo sapiens (human)?to=0&format=json
0.188 | 0.012 | count_done; http://172.18.8.71:7700/v1/refseq/query?q=(nt:CACCACCGGATCAACTTCGACAAAT)?source=Homo sapiens (human)?to=0&format=json
0.199 | 0.011 | count_done; http://172.18.8.71:7700/v1/refseq/query?q=(nt:AACAGACACGGGTGAATGCTGCTAA)?source=Homo sapiens (human)?to=0&format=json
0.235 | 0.036 | search_done; http://172.18.8.71:7700/v1/refseq/query?q=(nt:TCTGCCCAACTGTCAACCTTGACAA)%26(nt:TACCACTTAAAGAGGAACCAGAGCT)%26(nt:GTGAACAGACACGGGTGAATGCTGC)%26(nt:GCGGTAATGCTGGTGGTCTGCATCA)%26(nt:GCCCAACTGTCAACCTTGACAAATT)%26(nt:GACTGAGGAAGACCCGGAAACTTAG)%26(nt:CCGGATCAACTTCGACAAATACCAC)%26(nt:CCGCGGTAATGCTGGTGGTCTGCAT)%26(nt:CACCGGATCAACTTCGACAAATACC)%26(nt:CACCACCGGATCAACTTCGACAAAT)%26(nt:AACAGACACGGGTGAATGCTGCTAA)?source=Homo sapiens (human)?to=49?from=0?snippet=full_search?drilldown=source?get=accession,version,gi,length,symbol,synonym,geneid,division,source,definition&format=json
0.236 | 0.001 | cgi_end;

GGRNA ver.2 by @meso_cacase at DBCLS
This page is licensed under a Creative Commons Attribution 4.0 International License (CC BY 4.0).

If you use GGRNA in your work, please cite:
Naito Y, Bono H. (2012)
GGRNA: an ultrafast, transcript-oriented search engine for genes and transcripts.
Nucleic Acids Res., 40, W592-W596. [Full Text]