GGRNA ver.2 Help | Advanced search | Japanese    Previous release (v1)

2021-01-24 06:23:51, GGRNA : RefSeq release 203 (Nov, 2020)

Summary:

Results:

Matches are highlighted with green background. Overlapping matches are dark colored.

Homo sapiens small nuclear ribonucleoprotein D1 polypeptide (SNRPD1), transcript variant 1, mRNA. (4858 bp)
PUBMED 3260384 cttgacgtccggagcccctggagtaggcgcttccggccattcatactgcagtcggtcagtgttcggttgaaggattctgtgtgctgtcggacccagagggtgacggcgccgctaggatgaagctcgtgagatttttgatgaaattgagtcatgaaactgtaaccattgaattgaagaacggaacacaggtccatggaacaatcacaggtgtggatgtcagcatgaatacacatcttaaagctgtgaaaatgaccctgaagaacagagaacctgtacagctggaaacgctgagtattcgaggaaataacattcggtattttattctaccagacagtttacctctggatacactacttgtggatgttgaacctaaggtgaaatctaagaaaagggaagctgttgcaggaagaggcagaggaagaggaagaggaagaggacgtggccgtggcagaggaagagggggtcctaggcgataatgtctctcaagatttcaaagtcatatgagatttgggatattttttgtacaggttgtgtttgtttatgtcagtttttaataaacataaatgtgggacagagctgtctatt...
position 31 47 65 173 186 260 278 334 462 477 510
Synonym: HsT2456; Sm-D1; SMD1; SNRPD
NM_006938.4 - Homo sapiens (human) - NCBI - UCSC - RefEx(expression)

Data Export:

Maximum 10000 results can be retrieved as Tab-delimited text or JSON format.

Debug Info:

Redirect URI : http://ggrna.dbcls.jp/hs/202690_s_at
lang : en | div : | spe : hs | query_string : 202690_s_at | format : html | download :

0.000 | 0.000 | search_start;
0.101 | 0.101 | count_done; http://172.18.8.71:7700/v1/refseq/query?q=(nt:TTCCGGCCATTCATACTGCAGTCGG)?source=Homo sapiens (human)?to=0&format=json
0.112 | 0.011 | count_done; http://172.18.8.71:7700/v1/refseq/query?q=(nt:TGTCTCTCAAGATTTCAAAGTCATA)?source=Homo sapiens (human)?to=0&format=json
0.124 | 0.012 | count_done; http://172.18.8.71:7700/v1/refseq/query?q=(nt:TGCAGTCGGTCAGTGTTCGGTTGAA)?source=Homo sapiens (human)?to=0&format=json
0.136 | 0.012 | count_done; http://172.18.8.71:7700/v1/refseq/query?q=(nt:GTTTACCTCTGGATACACTACTTGT)?source=Homo sapiens (human)?to=0&format=json
0.147 | 0.011 | count_done; http://172.18.8.71:7700/v1/refseq/query?q=(nt:GGTTGAAGGATTCTGTGTGCTGTCG)?source=Homo sapiens (human)?to=0&format=json
0.158 | 0.011 | count_done; http://172.18.8.71:7700/v1/refseq/query?q=(nt:GGTCCTAGGCGATAATGTCTCTCAA)?source=Homo sapiens (human)?to=0&format=json
0.169 | 0.011 | count_done; http://172.18.8.71:7700/v1/refseq/query?q=(nt:GGGATATTTTTTGTACAGGTTGTGT)?source=Homo sapiens (human)?to=0&format=json
0.179 | 0.011 | count_done; http://172.18.8.71:7700/v1/refseq/query?q=(nt:GCTGGAAACGCTGAGTATTCGAGGA)?source=Homo sapiens (human)?to=0&format=json
0.191 | 0.011 | count_done; http://172.18.8.71:7700/v1/refseq/query?q=(nt:GAAGAACGGAACACAGGTCCATGGA)?source=Homo sapiens (human)?to=0&format=json
0.201 | 0.010 | count_done; http://172.18.8.71:7700/v1/refseq/query?q=(nt:GAACAGAGAACCTGTACAGCTGGAA)?source=Homo sapiens (human)?to=0&format=json
0.213 | 0.012 | count_done; http://172.18.8.71:7700/v1/refseq/query?q=(nt:CAGGTCCATGGAACAATCACAGGTG)?source=Homo sapiens (human)?to=0&format=json
0.253 | 0.040 | search_done; http://172.18.8.71:7700/v1/refseq/query?q=(nt:TTCCGGCCATTCATACTGCAGTCGG)%26(nt:TGTCTCTCAAGATTTCAAAGTCATA)%26(nt:TGCAGTCGGTCAGTGTTCGGTTGAA)%26(nt:GTTTACCTCTGGATACACTACTTGT)%26(nt:GGTTGAAGGATTCTGTGTGCTGTCG)%26(nt:GGTCCTAGGCGATAATGTCTCTCAA)%26(nt:GGGATATTTTTTGTACAGGTTGTGT)%26(nt:GCTGGAAACGCTGAGTATTCGAGGA)%26(nt:GAAGAACGGAACACAGGTCCATGGA)%26(nt:GAACAGAGAACCTGTACAGCTGGAA)%26(nt:CAGGTCCATGGAACAATCACAGGTG)?source=Homo sapiens (human)?to=49?from=0?snippet=full_search?drilldown=source?get=accession,version,gi,length,symbol,synonym,geneid,division,source,definition&format=json
0.254 | 0.001 | cgi_end;

GGRNA ver.2 by @meso_cacase at DBCLS
This page is licensed under a Creative Commons Attribution 4.0 International License (CC BY 4.0).

If you use GGRNA in your work, please cite:
Naito Y, Bono H. (2012)
GGRNA: an ultrafast, transcript-oriented search engine for genes and transcripts.
Nucleic Acids Res., 40, W592-W596. [Full Text]