GGRNA ver.2 Help | Advanced search | Japanese    Previous release (v1)

2021-01-24 06:23:19, GGRNA : RefSeq release 203 (Nov, 2020)

Summary:

Results:

Matches are highlighted with green background. Overlapping matches are dark colored.

PREDICTED: Homo sapiens RAN binding protein 9 (RANBP9), transcript variant X2, mRNA. (2501 bp)
aattgggagatgttccgacccccactcccatataagcattcaatcagtgtaacttgcaaaatgcataaacatccgacagtttgaatttatagtgttgatggaagaaatcatttttaatgtgtactgtaaaacttgaaatactcaggagctgagtgaatatgtttgttgctacttacaatcccgacctgttagtcccagtagttttgttttaacatggtctttttcaactttgtttcctgtttaactacagatgacttctgttgtagactcacaagtttaactgttgtattataacagtattacatgtcaacggtgtggttatgacctttatttatataaaaaccaaatatttagtcaatttaccgtgtcttaatttaatctttgtacaccttccatttttaagtgcttaaatgagtactatattgcaataaaatgtagtgatataattaaccagccattaaaaatttacttctacaga
position 2167 2184 2193 2206 2272 2283 2371 2378 2395 2402 2457
Synonym: BPM-L; BPM90; RanBP7; RANBPM
XM_017010149.1 - Homo sapiens (human) - NCBI - UCSC - RefEx(expression)
PREDICTED: Homo sapiens RAN binding protein 9 (RANBP9), transcript variant X3, mRNA. (2593 bp)
aattgggagatgttccgacccccactcccatataagcattcaatcagtgtaacttgcaaaatgcataaacatccgacagtttgaatttatagtgttgatggaagaaatcatttttaatgtgtactgtaaaacttgaaatactcaggagctgagtgaatatgtttgttgctacttacaatcccgacctgttagtcccagtagttttgttttaacatggtctttttcaactttgtttcctgtttaactacagatgacttctgttgtagactcacaagtttaactgttgtattataacagtattacatgtcaacggtgtggttatgacctttatttatataaaaaccaaatatttagtcaatttaccgtgtcttaatttaatctttgtacaccttccatttttaagtgcttaaatgagtactatattgcaataaaatgtagtgatataattaaccagccattaaaaatttacttctacaga
position 2259 2276 2285 2298 2364 2375 2463 2470 2487 2494 2549
Synonym: BPM-L; BPM90; RanBP7; RANBPM
XM_006714945.2 - Homo sapiens (human) - NCBI - UCSC - RefEx(expression)
PREDICTED: Homo sapiens RAN binding protein 9 (RANBP9), transcript variant X1, mRNA. (2861 bp)
aattgggagatgttccgacccccactcccatataagcattcaatcagtgtaacttgcaaaatgcataaacatccgacagtttgaatttatagtgttgatggaagaaatcatttttaatgtgtactgtaaaacttgaaatactcaggagctgagtgaatatgtttgttgctacttacaatcccgacctgttagtcccagtagttttgttttaacatggtctttttcaactttgtttcctgtttaactacagatgacttctgttgtagactcacaagtttaactgttgtattataacagtattacatgtcaacggtgtggttatgacctttatttatataaaaaccaaatatttagtcaatttaccgtgtcttaatttaatctttgtacaccttccatttttaagtgcttaaatgagtactatattgcaataaaatgtagtgatataattaaccagccattaaaaatttacttctacaga
position 2527 2544 2553 2566 2632 2643 2731 2738 2755 2762 2817
Synonym: BPM-L; BPM90; RanBP7; RANBPM
XM_011514205.2 - Homo sapiens (human) - NCBI - UCSC - RefEx(expression)
Homo sapiens RAN binding protein 9 (RANBP9), mRNA. (3384 bp)
aattgggagatgttccgacccccactcccatataagcattcaatcagtgtaacttgcaaaatgcataaacatccgacagtttgaatttatagtgttgatggaagaaatcatttttaatgtgtactgtaaaacttgaaatactcaggagctgagtgaatatgtttgttgctacttacaatcccgacctgttagtcccagtagttttgttttaacatggtctttttcaactttgtttcctgtttaactacagatgacttctgttgtagactcacaagtttaactgttgtattataacagtattacatgtcaacggtgtggttatgacctttatttatataaaaaccaaatatttagtcaatttaccgtgtcttaatttaatctttgtacaccttccatttttaagtgcttaaatgagtactatattgcaataaaatgtagtgatataattaaccagccattaaaaatttacttctacaga
position 3050 3067 3076 3089 3155 3166 3254 3261 3278 3285 3340
Synonym: BPM-L; BPM90; RanBP7; RANBPM
NM_005493.3 - Homo sapiens (human) - NCBI - UCSC - RefEx(expression)

Data Export:

Maximum 10000 results can be retrieved as Tab-delimited text or JSON format.

Debug Info:

Redirect URI : http://ggrna.dbcls.jp/hs/202582_s_at
lang : en | div : | spe : hs | query_string : 202582_s_at | format : html | download :

0.000 | 0.000 | search_start;
0.167 | 0.167 | count_done; http://172.18.8.71:7700/v1/refseq/query?q=(nt:TGTAGTGATATAATTAACCAGCCAT)?source=Homo sapiens (human)?to=0&format=json
0.181 | 0.014 | count_done; http://172.18.8.71:7700/v1/refseq/query?q=(nt:TCTTTGTACACCTTCCATTTTTAAG)?source=Homo sapiens (human)?to=0&format=json
0.193 | 0.012 | count_done; http://172.18.8.71:7700/v1/refseq/query?q=(nt:TCAATTTACCGTGTCTTAATTTAAT)?source=Homo sapiens (human)?to=0&format=json
0.204 | 0.011 | count_done; http://172.18.8.71:7700/v1/refseq/query?q=(nt:TATTTAGTCAATTTACCGTGTCTTA)?source=Homo sapiens (human)?to=0&format=json
0.215 | 0.011 | count_done; http://172.18.8.71:7700/v1/refseq/query?q=(nt:TACTTACAATCCCGACCTGTTAGTC)?source=Homo sapiens (human)?to=0&format=json
0.227 | 0.012 | count_done; http://172.18.8.71:7700/v1/refseq/query?q=(nt:GTTTGTTGCTACTTACAATCCCGAC)?source=Homo sapiens (human)?to=0&format=json
0.238 | 0.011 | count_done; http://172.18.8.71:7700/v1/refseq/query?q=(nt:GTTGTAGACTCACAAGTTTAACTGT)?source=Homo sapiens (human)?to=0&format=json
0.250 | 0.012 | count_done; http://172.18.8.71:7700/v1/refseq/query?q=(nt:GACCTGTTAGTCCCAGTAGTTTTGT)?source=Homo sapiens (human)?to=0&format=json
0.261 | 0.012 | count_done; http://172.18.8.71:7700/v1/refseq/query?q=(nt:AGGAGCTGAGTGAATATGTTTGTTG)?source=Homo sapiens (human)?to=0&format=json
0.312 | 0.051 | count_done; http://172.18.8.71:7700/v1/refseq/query?q=(nt:AGATGACTTCTGTTGTAGACTCACA)?source=Homo sapiens (human)?to=0&format=json
0.563 | 0.251 | count_done; http://172.18.8.71:7700/v1/refseq/query?q=(nt:AATTTAATCTTTGTACACCTTCCAT)?source=Homo sapiens (human)?to=0&format=json
0.658 | 0.095 | search_done; http://172.18.8.71:7700/v1/refseq/query?q=(nt:TGTAGTGATATAATTAACCAGCCAT)%26(nt:TCTTTGTACACCTTCCATTTTTAAG)%26(nt:TCAATTTACCGTGTCTTAATTTAAT)%26(nt:TATTTAGTCAATTTACCGTGTCTTA)%26(nt:TACTTACAATCCCGACCTGTTAGTC)%26(nt:GTTTGTTGCTACTTACAATCCCGAC)%26(nt:GTTGTAGACTCACAAGTTTAACTGT)%26(nt:GACCTGTTAGTCCCAGTAGTTTTGT)%26(nt:AGGAGCTGAGTGAATATGTTTGTTG)%26(nt:AGATGACTTCTGTTGTAGACTCACA)%26(nt:AATTTAATCTTTGTACACCTTCCAT)?source=Homo sapiens (human)?to=49?from=0?snippet=full_search?drilldown=source?get=accession,version,gi,length,symbol,synonym,geneid,division,source,definition&format=json
0.661 | 0.003 | cgi_end;

GGRNA ver.2 by @meso_cacase at DBCLS
This page is licensed under a Creative Commons Attribution 4.0 International License (CC BY 4.0).

If you use GGRNA in your work, please cite:
Naito Y, Bono H. (2012)
GGRNA: an ultrafast, transcript-oriented search engine for genes and transcripts.
Nucleic Acids Res., 40, W592-W596. [Full Text]