GGRNA ver.2 Help | Advanced search | Japanese    Previous release (v1)

2021-01-17 00:07:16, GGRNA : RefSeq release 203 (Nov, 2020)

Summary:

Results:

Matches are highlighted with green background. Overlapping matches are dark colored.

Homo sapiens ER lipid raft associated 1 (ERLIN1), transcript variant 8, mRNA. (3054 bp)
aaatctttcagctgtcaggcctgtcagtctcatgacagtttgttggttgtgccaaacactttatttgggaaaggaaagcccagatttgaatgggtctttcccctgggccttatcctatagaggcatttgtaatatggagaaaataatttttcatttttgctcatttaattctataaattctctttataaatgaattttgtgttctttagttctccttaaaagaacttttgaattataaaaataaaatctttacctgtcgaattgttgctgcagatgattgttgtggaaaatctggatcattgacctctgtgctttcattcctagagatgttttatagttacatgagcaaaagctgttgccccaaagtgatggccctggaggcggggctgaggaacagggaaatgccgctgtgaagtcttaaagcacttctgcttaaactcccatgtgtgaggagtgtgcctccctgtgccctctcagctctgaggctggccgtctttcggggtgttccttttggcaaatatacactgtaatcttgagtctaaatttatatgttgaaatgctaccttttttaaaataagaaactaaataaaattattttac...
position 2480 2549 2647 2697 2713 2738 2789 2801 2827 2848 2996
Synonym: C10orf69; Erlin-1; KE04; KEO4; SPFH1; SPG62
NM_001347858.2 - Homo sapiens (human) - NCBI - UCSC - RefEx(expression)
Homo sapiens ER lipid raft associated 1 (ERLIN1), transcript variant 7, mRNA. (3081 bp)
aaatctttcagctgtcaggcctgtcagtctcatgacagtttgttggttgtgccaaacactttatttgggaaaggaaagcccagatttgaatgggtctttcccctgggccttatcctatagaggcatttgtaatatggagaaaataatttttcatttttgctcatttaattctataaattctctttataaatgaattttgtgttctttagttctccttaaaagaacttttgaattataaaaataaaatctttacctgtcgaattgttgctgcagatgattgttgtggaaaatctggatcattgacctctgtgctttcattcctagagatgttttatagttacatgagcaaaagctgttgccccaaagtgatggccctggaggcggggctgaggaacagggaaatgccgctgtgaagtcttaaagcacttctgcttaaactcccatgtgtgaggagtgtgcctccctgtgccctctcagctctgaggctggccgtctttcggggtgttccttttggcaaatatacactgtaatcttgagtctaaatttatatgttgaaatgctaccttttttaaaataagaaactaaataaaattattttac...
position 2507 2576 2674 2724 2740 2765 2816 2828 2854 2875 3023
Synonym: C10orf69; Erlin-1; KE04; KEO4; SPFH1; SPG62
NM_001347856.2 - Homo sapiens (human) - NCBI - UCSC - RefEx(expression)
Homo sapiens ER lipid raft associated 1 (ERLIN1), transcript variant 10, non-coding RNA. (3104 bp)
aaatctttcagctgtcaggcctgtcagtctcatgacagtttgttggttgtgccaaacactttatttgggaaaggaaagcccagatttgaatgggtctttcccctgggccttatcctatagaggcatttgtaatatggagaaaataatttttcatttttgctcatttaattctataaattctctttataaatgaattttgtgttctttagttctccttaaaagaacttttgaattataaaaataaaatctttacctgtcgaattgttgctgcagatgattgttgtggaaaatctggatcattgacctctgtgctttcattcctagagatgttttatagttacatgagcaaaagctgttgccccaaagtgatggccctggaggcggggctgaggaacagggaaatgccgctgtgaagtcttaaagcacttctgcttaaactcccatgtgtgaggagtgtgcctccctgtgccctctcagctctgaggctggccgtctttcggggtgttccttttggcaaatatacactgtaatcttgagtctaaatttatatgttgaaatgctaccttttttaaaataagaaactaaataaaattattttac...
position 2530 2599 2697 2747 2763 2788 2839 2851 2877 2898 3046
Synonym: C10orf69; Erlin-1; KE04; KEO4; SPFH1; SPG62
NR_144756.2 - Homo sapiens (human) - NCBI - UCSC - RefEx(expression)
Homo sapiens ER lipid raft associated 1 (ERLIN1), transcript variant 11, non-coding RNA. (3126 bp)
aaatctttcagctgtcaggcctgtcagtctcatgacagtttgttggttgtgccaaacactttatttgggaaaggaaagcccagatttgaatgggtctttcccctgggccttatcctatagaggcatttgtaatatggagaaaataatttttcatttttgctcatttaattctataaattctctttataaatgaattttgtgttctttagttctccttaaaagaacttttgaattataaaaataaaatctttacctgtcgaattgttgctgcagatgattgttgtggaaaatctggatcattgacctctgtgctttcattcctagagatgttttatagttacatgagcaaaagctgttgccccaaagtgatggccctggaggcggggctgaggaacagggaaatgccgctgtgaagtcttaaagcacttctgcttaaactcccatgtgtgaggagtgtgcctccctgtgccctctcagctctgaggctggccgtctttcggggtgttccttttggcaaatatacactgtaatcttgagtctaaatttatatgttgaaatgctaccttttttaaaataagaaactaaataaaattattttac...
position 2552 2621 2719 2769 2785 2810 2861 2873 2899 2920 3068
Synonym: C10orf69; Erlin-1; KE04; KEO4; SPFH1; SPG62
NR_144757.2 - Homo sapiens (human) - NCBI - UCSC - RefEx(expression)
Homo sapiens ER lipid raft associated 1 (ERLIN1), transcript variant 9, non-coding RNA. (3153 bp)
aaatctttcagctgtcaggcctgtcagtctcatgacagtttgttggttgtgccaaacactttatttgggaaaggaaagcccagatttgaatgggtctttcccctgggccttatcctatagaggcatttgtaatatggagaaaataatttttcatttttgctcatttaattctataaattctctttataaatgaattttgtgttctttagttctccttaaaagaacttttgaattataaaaataaaatctttacctgtcgaattgttgctgcagatgattgttgtggaaaatctggatcattgacctctgtgctttcattcctagagatgttttatagttacatgagcaaaagctgttgccccaaagtgatggccctggaggcggggctgaggaacagggaaatgccgctgtgaagtcttaaagcacttctgcttaaactcccatgtgtgaggagtgtgcctccctgtgccctctcagctctgaggctggccgtctttcggggtgttccttttggcaaatatacactgtaatcttgagtctaaatttatatgttgaaatgctaccttttttaaaataagaaactaaataaaattattttac...
position 2579 2648 2746 2796 2812 2837 2888 2900 2926 2947 3095
Synonym: C10orf69; Erlin-1; KE04; KEO4; SPFH1; SPG62
NR_144755.2 - Homo sapiens (human) - NCBI - UCSC - RefEx(expression)
Homo sapiens ER lipid raft associated 1 (ERLIN1), transcript variant 3, mRNA. (3160 bp)
aaatctttcagctgtcaggcctgtcagtctcatgacagtttgttggttgtgccaaacactttatttgggaaaggaaagcccagatttgaatgggtctttcccctgggccttatcctatagaggcatttgtaatatggagaaaataatttttcatttttgctcatttaattctataaattctctttataaatgaattttgtgttctttagttctccttaaaagaacttttgaattataaaaataaaatctttacctgtcgaattgttgctgcagatgattgttgtggaaaatctggatcattgacctctgtgctttcattcctagagatgttttatagttacatgagcaaaagctgttgccccaaagtgatggccctggaggcggggctgaggaacagggaaatgccgctgtgaagtcttaaagcacttctgcttaaactcccatgtgtgaggagtgtgcctccctgtgccctctcagctctgaggctggccgtctttcggggtgttccttttggcaaatatacactgtaatcttgagtctaaatttatatgttgaaatgctaccttttttaaaataagaaactaaataaaattattttac...
position 2586 2655 2753 2803 2819 2844 2895 2907 2933 2954 3102
Synonym: C10orf69; Erlin-1; KE04; KEO4; SPFH1; SPG62
NM_001347857.2 - Homo sapiens (human) - NCBI - UCSC - RefEx(expression)
Homo sapiens ER lipid raft associated 1 (ERLIN1), transcript variant 2, mRNA. (3163 bp)
aaatctttcagctgtcaggcctgtcagtctcatgacagtttgttggttgtgccaaacactttatttgggaaaggaaagcccagatttgaatgggtctttcccctgggccttatcctatagaggcatttgtaatatggagaaaataatttttcatttttgctcatttaattctataaattctctttataaatgaattttgtgttctttagttctccttaaaagaacttttgaattataaaaataaaatctttacctgtcgaattgttgctgcagatgattgttgtggaaaatctggatcattgacctctgtgctttcattcctagagatgttttatagttacatgagcaaaagctgttgccccaaagtgatggccctggaggcggggctgaggaacagggaaatgccgctgtgaagtcttaaagcacttctgcttaaactcccatgtgtgaggagtgtgcctccctgtgccctctcagctctgaggctggccgtctttcggggtgttccttttggcaaatatacactgtaatcttgagtctaaatttatatgttgaaatgctaccttttttaaaataagaaactaaataaaattattttac...
position 2589 2658 2756 2806 2822 2847 2898 2910 2936 2957 3105
Synonym: C10orf69; Erlin-1; KE04; KEO4; SPFH1; SPG62
NM_001100626.2 - Homo sapiens (human) - NCBI - UCSC - RefEx(expression)
Homo sapiens ER lipid raft associated 1 (ERLIN1), transcript variant 5, mRNA. (3218 bp)
aaatctttcagctgtcaggcctgtcagtctcatgacagtttgttggttgtgccaaacactttatttgggaaaggaaagcccagatttgaatgggtctttcccctgggccttatcctatagaggcatttgtaatatggagaaaataatttttcatttttgctcatttaattctataaattctctttataaatgaattttgtgttctttagttctccttaaaagaacttttgaattataaaaataaaatctttacctgtcgaattgttgctgcagatgattgttgtggaaaatctggatcattgacctctgtgctttcattcctagagatgttttatagttacatgagcaaaagctgttgccccaaagtgatggccctggaggcggggctgaggaacagggaaatgccgctgtgaagtcttaaagcacttctgcttaaactcccatgtgtgaggagtgtgcctccctgtgccctctcagctctgaggctggccgtctttcggggtgttccttttggcaaatatacactgtaatcttgagtctaaatttatatgttgaaatgctaccttttttaaaataagaaactaaataaaattattttac...
position 2644 2713 2811 2861 2877 2902 2953 2965 2991 3012 3160
Synonym: C10orf69; Erlin-1; KE04; KEO4; SPFH1; SPG62
NM_001347860.2 - Homo sapiens (human) - NCBI - UCSC - RefEx(expression)
Homo sapiens ER lipid raft associated 1 (ERLIN1), transcript variant 6, mRNA. (3221 bp)
aaatctttcagctgtcaggcctgtcagtctcatgacagtttgttggttgtgccaaacactttatttgggaaaggaaagcccagatttgaatgggtctttcccctgggccttatcctatagaggcatttgtaatatggagaaaataatttttcatttttgctcatttaattctataaattctctttataaatgaattttgtgttctttagttctccttaaaagaacttttgaattataaaaataaaatctttacctgtcgaattgttgctgcagatgattgttgtggaaaatctggatcattgacctctgtgctttcattcctagagatgttttatagttacatgagcaaaagctgttgccccaaagtgatggccctggaggcggggctgaggaacagggaaatgccgctgtgaagtcttaaagcacttctgcttaaactcccatgtgtgaggagtgtgcctccctgtgccctctcagctctgaggctggccgtctttcggggtgttccttttggcaaatatacactgtaatcttgagtctaaatttatatgttgaaatgctaccttttttaaaataagaaactaaataaaattattttac...
position 2647 2716 2814 2864 2880 2905 2956 2968 2994 3015 3163
Synonym: C10orf69; Erlin-1; KE04; KEO4; SPFH1; SPG62
NM_001347861.2 - Homo sapiens (human) - NCBI - UCSC - RefEx(expression)
Homo sapiens ER lipid raft associated 1 (ERLIN1), transcript variant 12, non-coding RNA. (3235 bp)
aaatctttcagctgtcaggcctgtcagtctcatgacagtttgttggttgtgccaaacactttatttgggaaaggaaagcccagatttgaatgggtctttcccctgggccttatcctatagaggcatttgtaatatggagaaaataatttttcatttttgctcatttaattctataaattctctttataaatgaattttgtgttctttagttctccttaaaagaacttttgaattataaaaataaaatctttacctgtcgaattgttgctgcagatgattgttgtggaaaatctggatcattgacctctgtgctttcattcctagagatgttttatagttacatgagcaaaagctgttgccccaaagtgatggccctggaggcggggctgaggaacagggaaatgccgctgtgaagtcttaaagcacttctgcttaaactcccatgtgtgaggagtgtgcctccctgtgccctctcagctctgaggctggccgtctttcggggtgttccttttggcaaatatacactgtaatcttgagtctaaatttatatgttgaaatgctaccttttttaaaataagaaactaaataaaattattttac...
position 2661 2730 2828 2878 2894 2919 2970 2982 3008 3029 3177
Synonym: C10orf69; Erlin-1; KE04; KEO4; SPFH1; SPG62
NR_144758.2 - Homo sapiens (human) - NCBI - UCSC - RefEx(expression)
Homo sapiens ER lipid raft associated 1 (ERLIN1), transcript variant 14, non-coding RNA. (3267 bp)
aaatctttcagctgtcaggcctgtcagtctcatgacagtttgttggttgtgccaaacactttatttgggaaaggaaagcccagatttgaatgggtctttcccctgggccttatcctatagaggcatttgtaatatggagaaaataatttttcatttttgctcatttaattctataaattctctttataaatgaattttgtgttctttagttctccttaaaagaacttttgaattataaaaataaaatctttacctgtcgaattgttgctgcagatgattgttgtggaaaatctggatcattgacctctgtgctttcattcctagagatgttttatagttacatgagcaaaagctgttgccccaaagtgatggccctggaggcggggctgaggaacagggaaatgccgctgtgaagtcttaaagcacttctgcttaaactcccatgtgtgaggagtgtgcctccctgtgccctctcagctctgaggctggccgtctttcggggtgttccttttggcaaatatacactgtaatcttgagtctaaatttatatgttgaaatgctaccttttttaaaataagaaactaaataaaattattttac...
position 2693 2762 2860 2910 2926 2951 3002 3014 3040 3061 3209
Synonym: C10orf69; Erlin-1; KE04; KEO4; SPFH1; SPG62
NR_144760.2 - Homo sapiens (human) - NCBI - UCSC - RefEx(expression)
Homo sapiens ER lipid raft associated 1 (ERLIN1), transcript variant 13, non-coding RNA. (3293 bp)
aaatctttcagctgtcaggcctgtcagtctcatgacagtttgttggttgtgccaaacactttatttgggaaaggaaagcccagatttgaatgggtctttcccctgggccttatcctatagaggcatttgtaatatggagaaaataatttttcatttttgctcatttaattctataaattctctttataaatgaattttgtgttctttagttctccttaaaagaacttttgaattataaaaataaaatctttacctgtcgaattgttgctgcagatgattgttgtggaaaatctggatcattgacctctgtgctttcattcctagagatgttttatagttacatgagcaaaagctgttgccccaaagtgatggccctggaggcggggctgaggaacagggaaatgccgctgtgaagtcttaaagcacttctgcttaaactcccatgtgtgaggagtgtgcctccctgtgccctctcagctctgaggctggccgtctttcggggtgttccttttggcaaatatacactgtaatcttgagtctaaatttatatgttgaaatgctaccttttttaaaataagaaactaaataaaattattttac...
position 2719 2788 2886 2936 2952 2977 3028 3040 3066 3087 3235
Synonym: C10orf69; Erlin-1; KE04; KEO4; SPFH1; SPG62
NR_144759.2 - Homo sapiens (human) - NCBI - UCSC - RefEx(expression)
Homo sapiens ER lipid raft associated 1 (ERLIN1), transcript variant 4, mRNA. (3326 bp)
aaatctttcagctgtcaggcctgtcagtctcatgacagtttgttggttgtgccaaacactttatttgggaaaggaaagcccagatttgaatgggtctttcccctgggccttatcctatagaggcatttgtaatatggagaaaataatttttcatttttgctcatttaattctataaattctctttataaatgaattttgtgttctttagttctccttaaaagaacttttgaattataaaaataaaatctttacctgtcgaattgttgctgcagatgattgttgtggaaaatctggatcattgacctctgtgctttcattcctagagatgttttatagttacatgagcaaaagctgttgccccaaagtgatggccctggaggcggggctgaggaacagggaaatgccgctgtgaagtcttaaagcacttctgcttaaactcccatgtgtgaggagtgtgcctccctgtgccctctcagctctgaggctggccgtctttcggggtgttccttttggcaaatatacactgtaatcttgagtctaaatttatatgttgaaatgctaccttttttaaaataagaaactaaataaaattattttac...
position 2752 2821 2919 2969 2985 3010 3061 3073 3099 3120 3268
Synonym: C10orf69; Erlin-1; KE04; KEO4; SPFH1; SPG62
NM_001347859.2 - Homo sapiens (human) - NCBI - UCSC - RefEx(expression)
Homo sapiens ER lipid raft associated 1 (ERLIN1), transcript variant 1, mRNA. (3487 bp)
aaatctttcagctgtcaggcctgtcagtctcatgacagtttgttggttgtgccaaacactttatttgggaaaggaaagcccagatttgaatgggtctttcccctgggccttatcctatagaggcatttgtaatatggagaaaataatttttcatttttgctcatttaattctataaattctctttataaatgaattttgtgttctttagttctccttaaaagaacttttgaattataaaaataaaatctttacctgtcgaattgttgctgcagatgattgttgtggaaaatctggatcattgacctctgtgctttcattcctagagatgttttatagttacatgagcaaaagctgttgccccaaagtgatggccctggaggcggggctgaggaacagggaaatgccgctgtgaagtcttaaagcacttctgcttaaactcccatgtgtgaggagtgtgcctccctgtgccctctcagctctgaggctggccgtctttcggggtgttccttttggcaaatatacactgtaatcttgagtctaaatttatatgttgaaatgctaccttttttaaaataagaaactaaataaaattattttac...
position 2913 2982 3080 3130 3146 3171 3222 3234 3260 3281 3429
Synonym: C10orf69; Erlin-1; KE04; KEO4; SPFH1; SPG62
NM_006459.4 - Homo sapiens (human) - NCBI - UCSC - RefEx(expression)

Data Export:

Maximum 10000 results can be retrieved as Tab-delimited text or JSON format.

Debug Info:

Redirect URI : http://ggrna.dbcls.jp/hs/202441_at
lang : en | div : | spe : hs | query_string : 202441_at | format : html | download :

0.000 | 0.000 | search_start;
0.088 | 0.088 | count_done; http://172.18.8.71:7700/v1/refseq/query?q=(nt:TGTGTTCTTTAGTTCTCCTTAAAAG)?source=Homo sapiens (human)?to=0&format=json
0.101 | 0.013 | count_done; http://172.18.8.71:7700/v1/refseq/query?q=(nt:GTTGCTGCAGATGATTGTTGTGGAA)?source=Homo sapiens (human)?to=0&format=json
0.112 | 0.011 | count_done; http://172.18.8.71:7700/v1/refseq/query?q=(nt:GCTGTTGCCCCAAAGTGATGGCCCT)?source=Homo sapiens (human)?to=0&format=json
0.123 | 0.011 | count_done; http://172.18.8.71:7700/v1/refseq/query?q=(nt:GAGGCGGGGCTGAGGAACAGGGAAA)?source=Homo sapiens (human)?to=0&format=json
0.133 | 0.010 | count_done; http://172.18.8.71:7700/v1/refseq/query?q=(nt:GAAATGCCGCTGTGAAGTCTTAAAG)?source=Homo sapiens (human)?to=0&format=json
0.144 | 0.011 | count_done; http://172.18.8.71:7700/v1/refseq/query?q=(nt:CTTTACCTGTCGAATTGTTGCTGCA)?source=Homo sapiens (human)?to=0&format=json
0.154 | 0.010 | count_done; http://172.18.8.71:7700/v1/refseq/query?q=(nt:CCCCTGGGCCTTATCCTATAGAGGC)?source=Homo sapiens (human)?to=0&format=json
0.166 | 0.012 | count_done; http://172.18.8.71:7700/v1/refseq/query?q=(nt:CATGACAGTTTGTTGGTTGTGCCAA)?source=Homo sapiens (human)?to=0&format=json
0.176 | 0.010 | count_done; http://172.18.8.71:7700/v1/refseq/query?q=(nt:ATATGTTGAAATGCTACCTTTTTTA)?source=Homo sapiens (human)?to=0&format=json
0.186 | 0.010 | count_done; http://172.18.8.71:7700/v1/refseq/query?q=(nt:ACATGAGCAAAAGCTGTTGCCCCAA)?source=Homo sapiens (human)?to=0&format=json
0.196 | 0.010 | count_done; http://172.18.8.71:7700/v1/refseq/query?q=(nt:AATCTGGATCATTGACCTCTGTGCT)?source=Homo sapiens (human)?to=0&format=json
0.513 | 0.317 | search_done; http://172.18.8.71:7700/v1/refseq/query?q=(nt:TGTGTTCTTTAGTTCTCCTTAAAAG)%26(nt:GTTGCTGCAGATGATTGTTGTGGAA)%26(nt:GCTGTTGCCCCAAAGTGATGGCCCT)%26(nt:GAGGCGGGGCTGAGGAACAGGGAAA)%26(nt:GAAATGCCGCTGTGAAGTCTTAAAG)%26(nt:CTTTACCTGTCGAATTGTTGCTGCA)%26(nt:CCCCTGGGCCTTATCCTATAGAGGC)%26(nt:CATGACAGTTTGTTGGTTGTGCCAA)%26(nt:ATATGTTGAAATGCTACCTTTTTTA)%26(nt:ACATGAGCAAAAGCTGTTGCCCCAA)%26(nt:AATCTGGATCATTGACCTCTGTGCT)?source=Homo sapiens (human)?to=49?from=0?snippet=full_search?drilldown=source?get=accession,version,gi,length,symbol,synonym,geneid,division,source,definition&format=json
0.522 | 0.009 | cgi_end;

GGRNA ver.2 by @meso_cacase at DBCLS
This page is licensed under a Creative Commons Attribution 4.0 International License (CC BY 4.0).

If you use GGRNA in your work, please cite:
Naito Y, Bono H. (2012)
GGRNA: an ultrafast, transcript-oriented search engine for genes and transcripts.
Nucleic Acids Res., 40, W592-W596. [Full Text]