GGRNA ver.2 Help | Advanced search | Japanese    Previous release (v1)

2021-01-17 00:28:42, GGRNA : RefSeq release 203 (Nov, 2020)

Summary:

Results:

Matches are highlighted with green background. Overlapping matches are dark colored.

Homo sapiens ATP synthase peripheral stalk subunit F6 (ATP5PF), transcript variant 1, mRNA; nuclear gene for mitochondrial product. (526 bp)
agagcggaggtggtggcggcggaggctttggcagctcgggactgagtgcaagaatcagcatgattcttcagaggctcttcaggttctcctctgtcattcggtcagccgtctcagtccatttgcggaggaacattggtgttacagcagtggcatttaataaggaacttgatcctatacagaaactctttgtggacaagattagagaatacaaatctaagcgacagacatctggaggacctgttgatgctagttcagagtatcagcaagagctggagagggagctttttaagctcaagcaaatgtttggtaatgcagacatgaatacatttcccaccttcaaatttgaagatcccaaatttgaagtcatcgaaaaaccccaggcctgaagaaataaagtaaaattaatctggtaatttgtcacggattagttgtacaactagttagaagtttcagaataaacatgcatttcataactgtcaaatgttcttttaattctgagtccaaataaattatttggtgatgttga
position 106 121 135 161 218 231 314 359 401 415 456
Synonym: ATP5; ATP5A; ATP5J; ATPM; CF6; F6
NM_001003703.2 - Homo sapiens (human) - NCBI - UCSC - RefEx(expression)
Homo sapiens ATP synthase peripheral stalk subunit F6 (ATP5PF), transcript variant 2, mRNA; nuclear gene for mitochondrial product. (540 bp)
ggcttctgtctcacctagacccgtccggtcgcagactgtctccgagacgcttcctgtccgaatcagcatgattcttcagaggctcttcaggttctcctctgtcattcggtcagccgtctcagtccatttgcggaggaacattggtgttacagcagtggcatttaataaggaacttgatcctatacagaaactctttgtggacaagattagagaatacaaatctaagcgacagacatctggaggacctgttgatgctagttcagagtatcagcaagagctggagagggagctttttaagctcaagcaaatgtttggtaatgcagacatgaatacatttcccaccttcaaatttgaagatcccaaatttgaagtcatcgaaaaaccccaggcctgaagaaataaagtaaaattaatctggtaatttgtcacggattagttgtacaactagttagaagtttcagaataaacatgcatttcataactgtcaaatgttcttttaattctgagtccaaataaattatttggtgatgttga
position 120 135 149 175 232 245 328 373 415 429 470
Synonym: ATP5; ATP5A; ATP5J; ATPM; CF6; F6
NM_001685.5 - Homo sapiens (human) - NCBI - UCSC - RefEx(expression)
Homo sapiens ATP synthase peripheral stalk subunit F6 (ATP5PF), transcript variant 6, mRNA; nuclear gene for mitochondrial product. (569 bp)
tcgggactgagtgcaaggaatatgcactgaagaggcagcgaacctactaacctttggccgaatcagcatgattcttcagaggctcttcaggttctcctctgtcattcggtcagccgtctcagtccatttgcggaggaacattggtgttacagcagtggcatttaataaggaacttgatcctatacagaaactctttgtggacaagattagagaatacaaatctaagcgacagacatctggaggacctgttgatgctagttcagagtatcagcaagagctggagagggagctttttaagctcaagcaaatgtttggtaatgcagacatgaatacatttcccaccttcaaatttgaagatcccaaatttgaagtcatcgaaaaaccccaggcctgaagaaataaagtaaaattaatctggtaatttgtcacggattagttgtacaactagttagaagtttcagaataaacatgcatttcataactgtcaaatgttcttttaattctgagtccaaataaattatttggtgatgttga
position 149 164 178 204 261 274 357 402 444 458 499
Synonym: ATP5; ATP5A; ATP5J; ATPM; CF6; F6
NM_001320266.2 - Homo sapiens (human) - NCBI - UCSC - RefEx(expression)
Homo sapiens ATP synthase peripheral stalk subunit F6 (ATP5PF), transcript variant 5, mRNA; nuclear gene for mitochondrial product. (590 bp)
ttcctgtccggtgagcgtcgaccgactgaaacggcggcccataatgcattgcgatggcggaatcagcatgattcttcagaggctcttcaggttctcctctgtcattcggtcagccgtctcagtccatttgcggaggaacattggtgttacagcagtggcatttaataaggaacttgatcctatacagaaactctttgtggacaagattagagaatacaaatctaagcgacagacatctggaggacctgttgatgctagttcagagtatcagcaagagctggagagggagctttttaagctcaagcaaatgtttggtaatgcagacatgaatacatttcccaccttcaaatttgaagatcccaaatttgaagtcatcgaaaaaccccaggcctgaagaaataaagtaaaattaatctggtaatttgtcacggattagttgtacaactagttagaagtttcagaataaacatgcatttcataactgtcaaatgttcttttaattctgagtccaaataaattatttggtgatgttga
position 170 185 199 225 282 295 378 423 465 479 520
Synonym: ATP5; ATP5A; ATP5J; ATPM; CF6; F6
NM_001003701.2 - Homo sapiens (human) - NCBI - UCSC - RefEx(expression)
Homo sapiens ATP synthase peripheral stalk subunit F6 (ATP5PF), transcript variant 4, mRNA; nuclear gene for mitochondrial product. (641 bp)
gcactccagagccggctgagaacggcagcggcgagggctccacgtgcagcgtctctccggaatcagcatgattcttcagaggctcttcaggttctcctctgtcattcggtcagccgtctcagtccatttgcggaggaacattggtgttacagcagtggcatttaataaggaacttgatcctatacagaaactctttgtggacaagattagagaatacaaatctaagcgacagacatctggaggacctgttgatgctagttcagagtatcagcaagagctggagagggagctttttaagctcaagcaaatgtttggtaatgcagacatgaatacatttcccaccttcaaatttgaagatcccaaatttgaagtcatcgaaaaaccccaggcctgaagaaataaagtaaaattaatctggtaatttgtcacggattagttgtacaactagttagaagtttcagaataaacatgcatttcataactgtcaaatgttcttttaattctgagtccaaataaattatttggtgatgttga
position 221 236 250 276 333 346 429 474 516 530 571
Synonym: ATP5; ATP5A; ATP5J; ATPM; CF6; F6
NM_001003697.2 - Homo sapiens (human) - NCBI - UCSC - RefEx(expression)
Homo sapiens ATP synthase peripheral stalk subunit F6 (ATP5PF), transcript variant 3, mRNA; nuclear gene for mitochondrial product. (813 bp)
ggactacaactcccggcagggtgcgcaaaacgaccgcccaaggcaacggaggctcacgagaatcagcatgattcttcagaggctcttcaggttctcctctgtcattcggtcagccgtctcagtccatttgcggaggaacattggtgttacagcagtggcatttaataaggaacttgatcctatacagaaactctttgtggacaagattagagaatacaaatctaagcgacagacatctggaggacctgttgatgctagttcagagtatcagcaagagctggagagggagctttttaagctcaagcaaatgtttggtaatgcagacatgaatacatttcccaccttcaaatttgaagatcccaaatttgaagtcatcgaaaaaccccaggcctgaagaaataaagtaaaattaatctggtaatttgtcacggattagttgtacaactagttagaagtttcagaataaacatgcatttcataactgtcaaatgttcttttaattctgagtccaaataaattatttggtgatgttga
position 393 408 422 448 505 518 601 646 688 702 743
Synonym: ATP5; ATP5A; ATP5J; ATPM; CF6; F6
NM_001003696.2 - Homo sapiens (human) - NCBI - UCSC - RefEx(expression)
Homo sapiens ATP synthase peripheral stalk subunit F6 (ATP5PF), transcript variant 7, mRNA; nuclear gene for mitochondrial product. (1046 bp)
ttatggattgttcataggaatatgcactgaagaggcagcgaacctactaacctttggccgaatcagcatgattcttcagaggctcttcaggttctcctctgtcattcggtcagccgtctcagtccatttgcggaggaacattggtgttacagcagtggcatttaataaggaacttgatcctatacagaaactctttgtggacaagattagagaatacaaatctaagcgacagacatctggaggacctgttgatgctagttcagagtatcagcaagagctggagagggagctttttaagctcaagcaaatgtttggtaatgcagacatgaatacatttcccaccttcaaatttgaagatcccaaatttgaagtcatcgaaaaaccccaggcctgaagaaataaagtaaaattaatctggtaatttgtcacggattagttgtacaactagttagaagtttcagaataaacatgcatttcataactgtcaaatgttcttttaattctgagtccaaataaattatttggtgatgttga
position 626 641 655 681 738 751 834 879 921 935 976
Synonym: ATP5; ATP5A; ATP5J; ATPM; CF6; F6
NM_001320267.2 - Homo sapiens (human) - NCBI - UCSC - RefEx(expression)

Data Export:

Maximum 10000 results can be retrieved as Tab-delimited text or JSON format.

Debug Info:

Redirect URI : http://ggrna.dbcls.jp/hs/202325_s_at
lang : en | div : | spe : hs | query_string : 202325_s_at | format : html | download :

0.000 | 0.000 | search_start;
0.090 | 0.090 | count_done; http://172.18.8.71:7700/v1/refseq/query?q=(nt:TTGTCACGGATTAGTTGTACAACTA)?source=Homo sapiens (human)?to=0&format=json
0.103 | 0.012 | count_done; http://172.18.8.71:7700/v1/refseq/query?q=(nt:TGCGGAGGAACATTGGTGTTACAGC)?source=Homo sapiens (human)?to=0&format=json
0.113 | 0.011 | count_done; http://172.18.8.71:7700/v1/refseq/query?q=(nt:TGAAGTCATCGAAAAACCCCAGGCC)?source=Homo sapiens (human)?to=0&format=json
0.123 | 0.010 | count_done; http://172.18.8.71:7700/v1/refseq/query?q=(nt:TAAACATGCATTTCATAACTGTCAA)?source=Homo sapiens (human)?to=0&format=json
0.135 | 0.012 | count_done; http://172.18.8.71:7700/v1/refseq/query?q=(nt:GGTGTTACAGCAGTGGCATTTAATA)?source=Homo sapiens (human)?to=0&format=json
0.144 | 0.009 | count_done; http://172.18.8.71:7700/v1/refseq/query?q=(nt:GGAGGACCTGTTGATGCTAGTTCAG)?source=Homo sapiens (human)?to=0&format=json
0.155 | 0.010 | count_done; http://172.18.8.71:7700/v1/refseq/query?q=(nt:GGAACTTGATCCTATACAGAAACTC)?source=Homo sapiens (human)?to=0&format=json
0.165 | 0.010 | count_done; http://172.18.8.71:7700/v1/refseq/query?q=(nt:GCGACAGACATCTGGAGGACCTGTT)?source=Homo sapiens (human)?to=0&format=json
0.177 | 0.012 | count_done; http://172.18.8.71:7700/v1/refseq/query?q=(nt:CCGTCTCAGTCCATTTGCGGAGGAA)?source=Homo sapiens (human)?to=0&format=json
0.187 | 0.010 | count_done; http://172.18.8.71:7700/v1/refseq/query?q=(nt:ATTAATCTGGTAATTTGTCACGGAT)?source=Homo sapiens (human)?to=0&format=json
0.197 | 0.010 | count_done; http://172.18.8.71:7700/v1/refseq/query?q=(nt:AGACATGAATACATTTCCCACCTTC)?source=Homo sapiens (human)?to=0&format=json
0.279 | 0.081 | search_done; http://172.18.8.71:7700/v1/refseq/query?q=(nt:TTGTCACGGATTAGTTGTACAACTA)%26(nt:TGCGGAGGAACATTGGTGTTACAGC)%26(nt:TGAAGTCATCGAAAAACCCCAGGCC)%26(nt:TAAACATGCATTTCATAACTGTCAA)%26(nt:GGTGTTACAGCAGTGGCATTTAATA)%26(nt:GGAGGACCTGTTGATGCTAGTTCAG)%26(nt:GGAACTTGATCCTATACAGAAACTC)%26(nt:GCGACAGACATCTGGAGGACCTGTT)%26(nt:CCGTCTCAGTCCATTTGCGGAGGAA)%26(nt:ATTAATCTGGTAATTTGTCACGGAT)%26(nt:AGACATGAATACATTTCCCACCTTC)?source=Homo sapiens (human)?to=49?from=0?snippet=full_search?drilldown=source?get=accession,version,gi,length,symbol,synonym,geneid,division,source,definition&format=json
0.283 | 0.005 | cgi_end;

GGRNA ver.2 by @meso_cacase at DBCLS
This page is licensed under a Creative Commons Attribution 4.0 International License (CC BY 4.0).

If you use GGRNA in your work, please cite:
Naito Y, Bono H. (2012)
GGRNA: an ultrafast, transcript-oriented search engine for genes and transcripts.
Nucleic Acids Res., 40, W592-W596. [Full Text]