GGRNA ver.2 Help | Advanced search | Japanese    Previous release (v1)

2021-01-17 00:41:10, GGRNA : RefSeq release 203 (Nov, 2020)

Summary:

Results:

Matches are highlighted with green background. Overlapping matches are dark colored.

Homo sapiens cytochrome c oxidase subunit 7B (COX7B), mRNA; nuclear gene for mitochondrial product. (2444 bp)
c oxidase subunits JOURNAL Eur J Biochem 156 (1), 199-204 (1986) PUBMED 3007143 gtttttcagctcacttcaagggtacctgaagcgaattggcaccaaagcagcagctgtattgccgcagttctagcttcaccttcacgatgtttcccttggtcaaaagcgcactaaatcgtctccaagttcgaagcattcagcaaacaatggcaaggcagagccaccagaaacgtacacctgattttcatgacaaatacggtaatgctgtattagctagtggagccactttctgtattgttacatggacatatgtagcaacacaagtcggaatagaatggaacctgtcccctgttggcagagttaccccaaaggaatggaggaatcagtaatcatcccagctggtgtaataatgaattgtttaaaaaacagctcataattgatgccaaattaaagcactgtgtacccattaagatatggcattattgaagaaataaagtacatttgaaaccttcattgtaggttttgtttctttgtaaatgaaactaagcttgatcactttagcctttatgttaatattaaa...
position 6 22 54 82 89 103 220 316 326 363 390
Synonym: APLCC; LSDMCA2
NM_001866.3 - Homo sapiens (human) - NCBI - UCSC - RefEx(expression)

Data Export:

Maximum 10000 results can be retrieved as Tab-delimited text or JSON format.

Debug Info:

Redirect URI : http://ggrna.dbcls.jp/hs/202110_at
lang : en | div : | spe : hs | query_string : 202110_at | format : html | download :

0.000 | 0.000 | search_start;
0.089 | 0.088 | count_done; http://172.18.8.71:7700/v1/refseq/query?q=(nt:TCAGCTCACTTCAAGGGTACCTGAA)?source=Homo sapiens (human)?to=0&format=json
0.101 | 0.012 | count_done; http://172.18.8.71:7700/v1/refseq/query?q=(nt:TCACGATGTTTCCCTTGGTCAAAAG)?source=Homo sapiens (human)?to=0&format=json
0.113 | 0.013 | count_done; http://172.18.8.71:7700/v1/refseq/query?q=(nt:GTTTCCCTTGGTCAAAAGCGCACTA)?source=Homo sapiens (human)?to=0&format=json
0.123 | 0.010 | count_done; http://172.18.8.71:7700/v1/refseq/query?q=(nt:GTACCTGAAGCGAATTGGCACCAAA)?source=Homo sapiens (human)?to=0&format=json
0.135 | 0.011 | count_done; http://172.18.8.71:7700/v1/refseq/query?q=(nt:GTAATCATCCCAGCTGGTGTAATAA)?source=Homo sapiens (human)?to=0&format=json
0.150 | 0.015 | count_done; http://172.18.8.71:7700/v1/refseq/query?q=(nt:GGAGGAATCAGTAATCATCCCAGCT)?source=Homo sapiens (human)?to=0&format=json
0.160 | 0.010 | count_done; http://172.18.8.71:7700/v1/refseq/query?q=(nt:GAGCCACTTTCTGTATTGTTACATG)?source=Homo sapiens (human)?to=0&format=json
0.170 | 0.010 | count_done; http://172.18.8.71:7700/v1/refseq/query?q=(nt:CTGTATTGCCGCAGTTCTAGCTTCA)?source=Homo sapiens (human)?to=0&format=json
0.182 | 0.012 | count_done; http://172.18.8.71:7700/v1/refseq/query?q=(nt:AAAGCGCACTAAATCGTCTCCAAGT)?source=Homo sapiens (human)?to=0&format=json
0.192 | 0.010 | count_done; http://172.18.8.71:7700/v1/refseq/query?q=(nt:AAAGCACTGTGTACCCATTAAGATA)?source=Homo sapiens (human)?to=0&format=json
0.202 | 0.010 | count_done; http://172.18.8.71:7700/v1/refseq/query?q=(nt:AAAACAGCTCATAATTGATGCCAAA)?source=Homo sapiens (human)?to=0&format=json
0.230 | 0.027 | search_done; http://172.18.8.71:7700/v1/refseq/query?q=(nt:TCAGCTCACTTCAAGGGTACCTGAA)%26(nt:TCACGATGTTTCCCTTGGTCAAAAG)%26(nt:GTTTCCCTTGGTCAAAAGCGCACTA)%26(nt:GTACCTGAAGCGAATTGGCACCAAA)%26(nt:GTAATCATCCCAGCTGGTGTAATAA)%26(nt:GGAGGAATCAGTAATCATCCCAGCT)%26(nt:GAGCCACTTTCTGTATTGTTACATG)%26(nt:CTGTATTGCCGCAGTTCTAGCTTCA)%26(nt:AAAGCGCACTAAATCGTCTCCAAGT)%26(nt:AAAGCACTGTGTACCCATTAAGATA)%26(nt:AAAACAGCTCATAATTGATGCCAAA)?source=Homo sapiens (human)?to=49?from=0?snippet=full_search?drilldown=source?get=accession,version,gi,length,symbol,synonym,geneid,division,source,definition&format=json
0.231 | 0.001 | cgi_end;

GGRNA ver.2 by @meso_cacase at DBCLS
This page is licensed under a Creative Commons Attribution 4.0 International License (CC BY 4.0).

If you use GGRNA in your work, please cite:
Naito Y, Bono H. (2012)
GGRNA: an ultrafast, transcript-oriented search engine for genes and transcripts.
Nucleic Acids Res., 40, W592-W596. [Full Text]