GGRNA ver.2 Help | Advanced search | Japanese    Previous release (v1)

2021-04-24 00:30:42, GGRNA : RefSeq release 205 (Mar, 2021)

Summary:

Results:

Matches are highlighted with green background. Overlapping matches are dark colored.

PREDICTED: Homo sapiens retinoic acid induced 14 (RAI14), transcript variant X13, mRNA. (4810 bp)
aaaccctgatatggtaatattatggtgcatagcagaggtctcggaaaaaaaatatttctgttcactttactttcaggttaaaaatgtttctaacacgcttgcaacttcccttatggcattaatcttgttgagggagagagacagaatcctggactctccaaagtatttaactgaaagtagggcctgctctgacagggcccatgtcccacaaggctgcttggcctcagtgggtgcttggctgtgctggatgatatgttgatctgtattggataaggaccaatgacagcaaagcaaaaatggctttaaagcttggtgttacttttcttaagttgtttaattatagttaagcaatttcaaaaatgctccaaagaaatgtgaaaggaccttttgtcacagcacttcagaaaatacacaacagccccttctgcccccgcacagaaatgctgcagagtatataaaacttgagacatttttgtaggatgcctgacgaggtgtagccttttatcttgtttccggatgcatatttattacgagtactctggttaaatattgaaaagttatatgctgtagtttttagtattttgtctttgtaatttacag...
position 4259 4275 4312 4351 4443 4550 4599 4638 4652 4667 4683
Synonym: NORPEG; RAI13
XM_011514025.2 - Homo sapiens (human) - NCBI - UCSC - RefEx(expression)
PREDICTED: Homo sapiens retinoic acid induced 14 (RAI14), transcript variant X9, mRNA. (4894 bp)
aaaccctgatatggtaatattatggtgcatagcagaggtctcggaaaaaaaatatttctgttcactttactttcaggttaaaaatgtttctaacacgcttgcaacttcccttatggcattaatcttgttgagggagagagacagaatcctggactctccaaagtatttaactgaaagtagggcctgctctgacagggcccatgtcccacaaggctgcttggcctcagtgggtgcttggctgtgctggatgatatgttgatctgtattggataaggaccaatgacagcaaagcaaaaatggctttaaagcttggtgttacttttcttaagttgtttaattatagttaagcaatttcaaaaatgctccaaagaaatgtgaaaggaccttttgtcacagcacttcagaaaatacacaacagccccttctgcccccgcacagaaatgctgcagagtatataaaacttgagacatttttgtaggatgcctgacgaggtgtagccttttatcttgtttccggatgcatatttattacgagtactctggttaaatattgaaaagttatatgctgtagtttttagtattttgtctttgtaatttacag...
position 4343 4359 4396 4435 4527 4634 4683 4722 4736 4751 4767
Synonym: NORPEG; RAI13
XM_011514022.1 - Homo sapiens (human) - NCBI - UCSC - RefEx(expression)
Homo sapiens retinoic acid induced 14 (RAI14), transcript variant 4, mRNA. (4899 bp)
aaaccctgatatggtaatattatggtgcatagcagaggtctcggaaaaaaaatatttctgttcactttactttcaggttaaaaatgtttctaacacgcttgcaacttcccttatggcattaatcttgttgagggagagagacagaatcctggactctccaaagtatttaactgaaagtagggcctgctctgacagggcccatgtcccacaaggctgcttggcctcagtgggtgcttggctgtgctggatgatatgttgatctgtattggataaggaccaatgacagcaaagcaaaaatggctttaaagcttggtgttacttttcttaagttgtttaattatagttaagcaatttcaaaaatgctccaaagaaatgtgaaaggaccttttgtcacagcacttcagaaaatacacaacagccccttctgcccccgcacagaaatgctgcagagtatataaaacttgagacatttttgtaggatgcctgacgaggtgtagccttttatcttgtttccggatgcatatttattacgagtactctggttaaatattgaaaagttatatgctgtagtttttagtattttgtctttgtaatttacag...
position 4348 4364 4401 4440 4532 4639 4688 4727 4741 4756 4772
Synonym: NORPEG; RAI13
NM_001145522.2 - Homo sapiens (human) - NCBI - UCSC - RefEx(expression)
PREDICTED: Homo sapiens retinoic acid induced 14 (RAI14), transcript variant X1, mRNA. (4900 bp)
aaaccctgatatggtaatattatggtgcatagcagaggtctcggaaaaaaaatatttctgttcactttactttcaggttaaaaatgtttctaacacgcttgcaacttcccttatggcattaatcttgttgagggagagagacagaatcctggactctccaaagtatttaactgaaagtagggcctgctctgacagggcccatgtcccacaaggctgcttggcctcagtgggtgcttggctgtgctggatgatatgttgatctgtattggataaggaccaatgacagcaaagcaaaaatggctttaaagcttggtgttacttttcttaagttgtttaattatagttaagcaatttcaaaaatgctccaaagaaatgtgaaaggaccttttgtcacagcacttcagaaaatacacaacagccccttctgcccccgcacagaaatgctgcagagtatataaaacttgagacatttttgtaggatgcctgacgaggtgtagccttttatcttgtttccggatgcatatttattacgagtactctggttaaatattgaaaagttatatgctgtagtttttagtattttgtctttgtaatttacag...
position 4349 4365 4402 4441 4533 4640 4689 4728 4742 4757 4773
Synonym: NORPEG; RAI13
XM_011514016.2 - Homo sapiens (human) - NCBI - UCSC - RefEx(expression)
Homo sapiens retinoic acid induced 14 (RAI14), transcript variant 5, mRNA. (4918 bp)
aaaccctgatatggtaatattatggtgcatagcagaggtctcggaaaaaaaatatttctgttcactttactttcaggttaaaaatgtttctaacacgcttgcaacttcccttatggcattaatcttgttgagggagagagacagaatcctggactctccaaagtatttaactgaaagtagggcctgctctgacagggcccatgtcccacaaggctgcttggcctcagtgggtgcttggctgtgctggatgatatgttgatctgtattggataaggaccaatgacagcaaagcaaaaatggctttaaagcttggtgttacttttcttaagttgtttaattatagttaagcaatttcaaaaatgctccaaagaaatgtgaaaggaccttttgtcacagcacttcagaaaatacacaacagccccttctgcccccgcacagaaatgctgcagagtatataaaacttgagacatttttgtaggatgcctgacgaggtgtagccttttatcttgtttccggatgcatatttattacgagtactctggttaaatattgaaaagttatatgctgtagtttttagtattttgtctttgtaatttacag...
position 4367 4383 4420 4459 4551 4658 4707 4746 4760 4775 4791
Synonym: NORPEG; RAI13
NM_001145523.2 - Homo sapiens (human) - NCBI - UCSC - RefEx(expression)
PREDICTED: Homo sapiens retinoic acid induced 14 (RAI14), transcript variant X12, mRNA. (4919 bp)
aaaccctgatatggtaatattatggtgcatagcagaggtctcggaaaaaaaatatttctgttcactttactttcaggttaaaaatgtttctaacacgcttgcaacttcccttatggcattaatcttgttgagggagagagacagaatcctggactctccaaagtatttaactgaaagtagggcctgctctgacagggcccatgtcccacaaggctgcttggcctcagtgggtgcttggctgtgctggatgatatgttgatctgtattggataaggaccaatgacagcaaagcaaaaatggctttaaagcttggtgttacttttcttaagttgtttaattatagttaagcaatttcaaaaatgctccaaagaaatgtgaaaggaccttttgtcacagcacttcagaaaatacacaacagccccttctgcccccgcacagaaatgctgcagagtatataaaacttgagacatttttgtaggatgcctgacgaggtgtagccttttatcttgtttccggatgcatatttattacgagtactctggttaaatattgaaaagttatatgctgtagtttttagtattttgtctttgtaatttacag...
position 4368 4384 4421 4460 4552 4659 4708 4747 4761 4776 4792
Synonym: NORPEG; RAI13
XM_024446017.1 - Homo sapiens (human) - NCBI - UCSC - RefEx(expression)
PREDICTED: Homo sapiens retinoic acid induced 14 (RAI14), transcript variant X11, mRNA. (4924 bp)
aaaccctgatatggtaatattatggtgcatagcagaggtctcggaaaaaaaatatttctgttcactttactttcaggttaaaaatgtttctaacacgcttgcaacttcccttatggcattaatcttgttgagggagagagacagaatcctggactctccaaagtatttaactgaaagtagggcctgctctgacagggcccatgtcccacaaggctgcttggcctcagtgggtgcttggctgtgctggatgatatgttgatctgtattggataaggaccaatgacagcaaagcaaaaatggctttaaagcttggtgttacttttcttaagttgtttaattatagttaagcaatttcaaaaatgctccaaagaaatgtgaaaggaccttttgtcacagcacttcagaaaatacacaacagccccttctgcccccgcacagaaatgctgcagagtatataaaacttgagacatttttgtaggatgcctgacgaggtgtagccttttatcttgtttccggatgcatatttattacgagtactctggttaaatattgaaaagttatatgctgtagtttttagtattttgtctttgtaatttacag...
position 4373 4389 4426 4465 4557 4664 4713 4752 4766 4781 4797
Synonym: NORPEG; RAI13
XM_011514024.2 - Homo sapiens (human) - NCBI - UCSC - RefEx(expression)
PREDICTED: Homo sapiens retinoic acid induced 14 (RAI14), transcript variant X10, mRNA. (4936 bp)
aaaccctgatatggtaatattatggtgcatagcagaggtctcggaaaaaaaatatttctgttcactttactttcaggttaaaaatgtttctaacacgcttgcaacttcccttatggcattaatcttgttgagggagagagacagaatcctggactctccaaagtatttaactgaaagtagggcctgctctgacagggcccatgtcccacaaggctgcttggcctcagtgggtgcttggctgtgctggatgatatgttgatctgtattggataaggaccaatgacagcaaagcaaaaatggctttaaagcttggtgttacttttcttaagttgtttaattatagttaagcaatttcaaaaatgctccaaagaaatgtgaaaggaccttttgtcacagcacttcagaaaatacacaacagccccttctgcccccgcacagaaatgctgcagagtatataaaacttgagacatttttgtaggatgcctgacgaggtgtagccttttatcttgtttccggatgcatatttattacgagtactctggttaaatattgaaaagttatatgctgtagtttttagtattttgtctttgtaatttacag...
position 4385 4401 4438 4477 4569 4676 4725 4764 4778 4793 4809
Synonym: NORPEG; RAI13
XM_011514023.1 - Homo sapiens (human) - NCBI - UCSC - RefEx(expression)
PREDICTED: Homo sapiens retinoic acid induced 14 (RAI14), transcript variant X15, mRNA. (4940 bp)
aaaccctgatatggtaatattatggtgcatagcagaggtctcggaaaaaaaatatttctgttcactttactttcaggttaaaaatgtttctaacacgcttgcaacttcccttatggcattaatcttgttgagggagagagacagaatcctggactctccaaagtatttaactgaaagtagggcctgctctgacagggcccatgtcccacaaggctgcttggcctcagtgggtgcttggctgtgctggatgatatgttgatctgtattggataaggaccaatgacagcaaagcaaaaatggctttaaagcttggtgttacttttcttaagttgtttaattatagttaagcaatttcaaaaatgctccaaagaaatgtgaaaggaccttttgtcacagcacttcagaaaatacacaacagccccttctgcccccgcacagaaatgctgcagagtatataaaacttgagacatttttgtaggatgcctgacgaggtgtagccttttatcttgtttccggatgcatatttattacgagtactctggttaaatattgaaaagttatatgctgtagtttttagtattttgtctttgtaatttacag...
position 4389 4405 4442 4481 4573 4680 4729 4768 4782 4797 4813
Synonym: NORPEG; RAI13
XM_017009336.2 - Homo sapiens (human) - NCBI - UCSC - RefEx(expression)
PREDICTED: Homo sapiens retinoic acid induced 14 (RAI14), transcript variant X3, mRNA. (4953 bp)
aaaccctgatatggtaatattatggtgcatagcagaggtctcggaaaaaaaatatttctgttcactttactttcaggttaaaaatgtttctaacacgcttgcaacttcccttatggcattaatcttgttgagggagagagacagaatcctggactctccaaagtatttaactgaaagtagggcctgctctgacagggcccatgtcccacaaggctgcttggcctcagtgggtgcttggctgtgctggatgatatgttgatctgtattggataaggaccaatgacagcaaagcaaaaatggctttaaagcttggtgttacttttcttaagttgtttaattatagttaagcaatttcaaaaatgctccaaagaaatgtgaaaggaccttttgtcacagcacttcagaaaatacacaacagccccttctgcccccgcacagaaatgctgcagagtatataaaacttgagacatttttgtaggatgcctgacgaggtgtagccttttatcttgtttccggatgcatatttattacgagtactctggttaaatattgaaaagttatatgctgtagtttttagtattttgtctttgtaatttacag...
position 4402 4418 4455 4494 4586 4693 4742 4781 4795 4810 4826
Synonym: NORPEG; RAI13
XM_006714469.2 - Homo sapiens (human) - NCBI - UCSC - RefEx(expression)
PREDICTED: Homo sapiens retinoic acid induced 14 (RAI14), transcript variant X14, mRNA. (4978 bp)
aaaccctgatatggtaatattatggtgcatagcagaggtctcggaaaaaaaatatttctgttcactttactttcaggttaaaaatgtttctaacacgcttgcaacttcccttatggcattaatcttgttgagggagagagacagaatcctggactctccaaagtatttaactgaaagtagggcctgctctgacagggcccatgtcccacaaggctgcttggcctcagtgggtgcttggctgtgctggatgatatgttgatctgtattggataaggaccaatgacagcaaagcaaaaatggctttaaagcttggtgttacttttcttaagttgtttaattatagttaagcaatttcaaaaatgctccaaagaaatgtgaaaggaccttttgtcacagcacttcagaaaatacacaacagccccttctgcccccgcacagaaatgctgcagagtatataaaacttgagacatttttgtaggatgcctgacgaggtgtagccttttatcttgtttccggatgcatatttattacgagtactctggttaaatattgaaaagttatatgctgtagtttttagtattttgtctttgtaatttacag...
position 4427 4443 4480 4519 4611 4718 4767 4806 4820 4835 4851
Synonym: NORPEG; RAI13
XM_017009335.1 - Homo sapiens (human) - NCBI - UCSC - RefEx(expression)
Homo sapiens retinoic acid induced 14 (RAI14), transcript variant 1, mRNA. (4986 bp)
aaaccctgatatggtaatattatggtgcatagcagaggtctcggaaaaaaaatatttctgttcactttactttcaggttaaaaatgtttctaacacgcttgcaacttcccttatggcattaatcttgttgagggagagagacagaatcctggactctccaaagtatttaactgaaagtagggcctgctctgacagggcccatgtcccacaaggctgcttggcctcagtgggtgcttggctgtgctggatgatatgttgatctgtattggataaggaccaatgacagcaaagcaaaaatggctttaaagcttggtgttacttttcttaagttgtttaattatagttaagcaatttcaaaaatgctccaaagaaatgtgaaaggaccttttgtcacagcacttcagaaaatacacaacagccccttctgcccccgcacagaaatgctgcagagtatataaaacttgagacatttttgtaggatgcctgacgaggtgtagccttttatcttgtttccggatgcatatttattacgagtactctggttaaatattgaaaagttatatgctgtagtttttagtattttgtctttgtaatttacag...
position 4435 4451 4488 4527 4619 4726 4775 4814 4828 4843 4859
Synonym: NORPEG; RAI13
NM_015577.3 - Homo sapiens (human) - NCBI - UCSC - RefEx(expression)
PREDICTED: Homo sapiens retinoic acid induced 14 (RAI14), transcript variant X8, mRNA. (5011 bp)
aaaccctgatatggtaatattatggtgcatagcagaggtctcggaaaaaaaatatttctgttcactttactttcaggttaaaaatgtttctaacacgcttgcaacttcccttatggcattaatcttgttgagggagagagacagaatcctggactctccaaagtatttaactgaaagtagggcctgctctgacagggcccatgtcccacaaggctgcttggcctcagtgggtgcttggctgtgctggatgatatgttgatctgtattggataaggaccaatgacagcaaagcaaaaatggctttaaagcttggtgttacttttcttaagttgtttaattatagttaagcaatttcaaaaatgctccaaagaaatgtgaaaggaccttttgtcacagcacttcagaaaatacacaacagccccttctgcccccgcacagaaatgctgcagagtatataaaacttgagacatttttgtaggatgcctgacgaggtgtagccttttatcttgtttccggatgcatatttattacgagtactctggttaaatattgaaaagttatatgctgtagtttttagtattttgtctttgtaatttacag...
position 4460 4476 4513 4552 4644 4751 4800 4839 4853 4868 4884
Synonym: NORPEG; RAI13
XM_011514020.1 - Homo sapiens (human) - NCBI - UCSC - RefEx(expression)
PREDICTED: Homo sapiens retinoic acid induced 14 (RAI14), transcript variant X7, mRNA. (5052 bp)
aaaccctgatatggtaatattatggtgcatagcagaggtctcggaaaaaaaatatttctgttcactttactttcaggttaaaaatgtttctaacacgcttgcaacttcccttatggcattaatcttgttgagggagagagacagaatcctggactctccaaagtatttaactgaaagtagggcctgctctgacagggcccatgtcccacaaggctgcttggcctcagtgggtgcttggctgtgctggatgatatgttgatctgtattggataaggaccaatgacagcaaagcaaaaatggctttaaagcttggtgttacttttcttaagttgtttaattatagttaagcaatttcaaaaatgctccaaagaaatgtgaaaggaccttttgtcacagcacttcagaaaatacacaacagccccttctgcccccgcacagaaatgctgcagagtatataaaacttgagacatttttgtaggatgcctgacgaggtgtagccttttatcttgtttccggatgcatatttattacgagtactctggttaaatattgaaaagttatatgctgtagtttttagtattttgtctttgtaatttacag...
position 4501 4517 4554 4593 4685 4792 4841 4880 4894 4909 4925
Synonym: NORPEG; RAI13
XM_011514019.1 - Homo sapiens (human) - NCBI - UCSC - RefEx(expression)
Homo sapiens retinoic acid induced 14 (RAI14), transcript variant 2, mRNA. (5068 bp)
aaaccctgatatggtaatattatggtgcatagcagaggtctcggaaaaaaaatatttctgttcactttactttcaggttaaaaatgtttctaacacgcttgcaacttcccttatggcattaatcttgttgagggagagagacagaatcctggactctccaaagtatttaactgaaagtagggcctgctctgacagggcccatgtcccacaaggctgcttggcctcagtgggtgcttggctgtgctggatgatatgttgatctgtattggataaggaccaatgacagcaaagcaaaaatggctttaaagcttggtgttacttttcttaagttgtttaattatagttaagcaatttcaaaaatgctccaaagaaatgtgaaaggaccttttgtcacagcacttcagaaaatacacaacagccccttctgcccccgcacagaaatgctgcagagtatataaaacttgagacatttttgtaggatgcctgacgaggtgtagccttttatcttgtttccggatgcatatttattacgagtactctggttaaatattgaaaagttatatgctgtagtttttagtattttgtctttgtaatttacag...
position 4493 4509 4546 4585 4677 4784 4833 4872 4886 4901 4917
Synonym: NORPEG; RAI13
NM_001145520.1 - Homo sapiens (human) - NCBI - UCSC - RefEx(expression)
PREDICTED: Homo sapiens retinoic acid induced 14 (RAI14), transcript variant X4, mRNA. (5077 bp)
aaaccctgatatggtaatattatggtgcatagcagaggtctcggaaaaaaaatatttctgttcactttactttcaggttaaaaatgtttctaacacgcttgcaacttcccttatggcattaatcttgttgagggagagagacagaatcctggactctccaaagtatttaactgaaagtagggcctgctctgacagggcccatgtcccacaaggctgcttggcctcagtgggtgcttggctgtgctggatgatatgttgatctgtattggataaggaccaatgacagcaaagcaaaaatggctttaaagcttggtgttacttttcttaagttgtttaattatagttaagcaatttcaaaaatgctccaaagaaatgtgaaaggaccttttgtcacagcacttcagaaaatacacaacagccccttctgcccccgcacagaaatgctgcagagtatataaaacttgagacatttttgtaggatgcctgacgaggtgtagccttttatcttgtttccggatgcatatttattacgagtactctggttaaatattgaaaagttatatgctgtagtttttagtattttgtctttgtaatttacag...
position 4526 4542 4579 4618 4710 4817 4866 4905 4919 4934 4950
Synonym: NORPEG; RAI13
XM_011514017.2 - Homo sapiens (human) - NCBI - UCSC - RefEx(expression)
PREDICTED: Homo sapiens retinoic acid induced 14 (RAI14), transcript variant X6, mRNA. (5078 bp)
aaaccctgatatggtaatattatggtgcatagcagaggtctcggaaaaaaaatatttctgttcactttactttcaggttaaaaatgtttctaacacgcttgcaacttcccttatggcattaatcttgttgagggagagagacagaatcctggactctccaaagtatttaactgaaagtagggcctgctctgacagggcccatgtcccacaaggctgcttggcctcagtgggtgcttggctgtgctggatgatatgttgatctgtattggataaggaccaatgacagcaaagcaaaaatggctttaaagcttggtgttacttttcttaagttgtttaattatagttaagcaatttcaaaaatgctccaaagaaatgtgaaaggaccttttgtcacagcacttcagaaaatacacaacagccccttctgcccccgcacagaaatgctgcagagtatataaaacttgagacatttttgtaggatgcctgacgaggtgtagccttttatcttgtttccggatgcatatttattacgagtactctggttaaatattgaaaagttatatgctgtagtttttagtattttgtctttgtaatttacag...
position 4527 4543 4580 4619 4711 4818 4867 4906 4920 4935 4951
Synonym: NORPEG; RAI13
XM_011514018.1 - Homo sapiens (human) - NCBI - UCSC - RefEx(expression)
PREDICTED: Homo sapiens retinoic acid induced 14 (RAI14), transcript variant X5, mRNA. (5095 bp)
aaaccctgatatggtaatattatggtgcatagcagaggtctcggaaaaaaaatatttctgttcactttactttcaggttaaaaatgtttctaacacgcttgcaacttcccttatggcattaatcttgttgagggagagagacagaatcctggactctccaaagtatttaactgaaagtagggcctgctctgacagggcccatgtcccacaaggctgcttggcctcagtgggtgcttggctgtgctggatgatatgttgatctgtattggataaggaccaatgacagcaaagcaaaaatggctttaaagcttggtgttacttttcttaagttgtttaattatagttaagcaatttcaaaaatgctccaaagaaatgtgaaaggaccttttgtcacagcacttcagaaaatacacaacagccccttctgcccccgcacagaaatgctgcagagtatataaaacttgagacatttttgtaggatgcctgacgaggtgtagccttttatcttgtttccggatgcatatttattacgagtactctggttaaatattgaaaagttatatgctgtagtttttagtattttgtctttgtaatttacag...
position 4544 4560 4597 4636 4728 4835 4884 4923 4937 4952 4968
Synonym: NORPEG; RAI13
XM_011514021.2 - Homo sapiens (human) - NCBI - UCSC - RefEx(expression)
PREDICTED: Homo sapiens retinoic acid induced 14 (RAI14), transcript variant X2, mRNA. (5095 bp)
aaaccctgatatggtaatattatggtgcatagcagaggtctcggaaaaaaaatatttctgttcactttactttcaggttaaaaatgtttctaacacgcttgcaacttcccttatggcattaatcttgttgagggagagagacagaatcctggactctccaaagtatttaactgaaagtagggcctgctctgacagggcccatgtcccacaaggctgcttggcctcagtgggtgcttggctgtgctggatgatatgttgatctgtattggataaggaccaatgacagcaaagcaaaaatggctttaaagcttggtgttacttttcttaagttgtttaattatagttaagcaatttcaaaaatgctccaaagaaatgtgaaaggaccttttgtcacagcacttcagaaaatacacaacagccccttctgcccccgcacagaaatgctgcagagtatataaaacttgagacatttttgtaggatgcctgacgaggtgtagccttttatcttgtttccggatgcatatttattacgagtactctggttaaatattgaaaagttatatgctgtagtttttagtattttgtctttgtaatttacag...
position 4544 4560 4597 4636 4728 4835 4884 4923 4937 4952 4968
Synonym: NORPEG; RAI13
XM_017009334.1 - Homo sapiens (human) - NCBI - UCSC - RefEx(expression)
Homo sapiens retinoic acid induced 14 (RAI14), transcript variant 3, mRNA. (5157 bp)
aaaccctgatatggtaatattatggtgcatagcagaggtctcggaaaaaaaatatttctgttcactttactttcaggttaaaaatgtttctaacacgcttgcaacttcccttatggcattaatcttgttgagggagagagacagaatcctggactctccaaagtatttaactgaaagtagggcctgctctgacagggcccatgtcccacaaggctgcttggcctcagtgggtgcttggctgtgctggatgatatgttgatctgtattggataaggaccaatgacagcaaagcaaaaatggctttaaagcttggtgttacttttcttaagttgtttaattatagttaagcaatttcaaaaatgctccaaagaaatgtgaaaggaccttttgtcacagcacttcagaaaatacacaacagccccttctgcccccgcacagaaatgctgcagagtatataaaacttgagacatttttgtaggatgcctgacgaggtgtagccttttatcttgtttccggatgcatatttattacgagtactctggttaaatattgaaaagttatatgctgtagtttttagtattttgtctttgtaatttacag...
position 4606 4622 4659 4698 4790 4897 4946 4985 4999 5014 5030
Synonym: NORPEG; RAI13
NM_001145521.2 - Homo sapiens (human) - NCBI - UCSC - RefEx(expression)
Homo sapiens retinoic acid induced 14 (RAI14), transcript variant 6, mRNA. (5338 bp)
aaaccctgatatggtaatattatggtgcatagcagaggtctcggaaaaaaaatatttctgttcactttactttcaggttaaaaatgtttctaacacgcttgcaacttcccttatggcattaatcttgttgagggagagagacagaatcctggactctccaaagtatttaactgaaagtagggcctgctctgacagggcccatgtcccacaaggctgcttggcctcagtgggtgcttggctgtgctggatgatatgttgatctgtattggataaggaccaatgacagcaaagcaaaaatggctttaaagcttggtgttacttttcttaagttgtttaattatagttaagcaatttcaaaaatgctccaaagaaatgtgaaaggaccttttgtcacagcacttcagaaaatacacaacagccccttctgcccccgcacagaaatgctgcagagtatataaaacttgagacatttttgtaggatgcctgacgaggtgtagccttttatcttgtttccggatgcatatttattacgagtactctggttaaatattgaaaagttatatgctgtagtttttagtattttgtctttgtaatttacag...
position 4787 4803 4840 4879 4971 5078 5127 5166 5180 5195 5211
Synonym: NORPEG; RAI13
NM_001145525.2 - Homo sapiens (human) - NCBI - UCSC - RefEx(expression)

Data Export:

Maximum 10000 results can be retrieved as Tab-delimited text or JSON format.

Debug Info:

Redirect URI : http://ggrna.dbcls.jp/hs/202052_s_at
lang : en | div : | spe : hs | query_string : 202052_s_at | format : html | download :

0.000 | 0.000 | search_start;
0.091 | 0.091 | count_done; http://172.18.8.71:7700/v1/refseq/query?q=(nt:TGTTTCTAACACGCTTGCAACTTCC)?source=Homo sapiens (human)?to=0&format=json
0.101 | 0.010 | count_done; http://172.18.8.71:7700/v1/refseq/query?q=(nt:TGTAGCCTTTTATCTTGTTTCCGGA)?source=Homo sapiens (human)?to=0&format=json
0.110 | 0.009 | count_done; http://172.18.8.71:7700/v1/refseq/query?q=(nt:TGAAAGGACCTTTTGTCACAGCACT)?source=Homo sapiens (human)?to=0&format=json
0.118 | 0.009 | count_done; http://172.18.8.71:7700/v1/refseq/query?q=(nt:GTTTCCGGATGCATATTTATTACGA)?source=Homo sapiens (human)?to=0&format=json
0.129 | 0.011 | count_done; http://172.18.8.71:7700/v1/refseq/query?q=(nt:GTAGGGCCTGCTCTGACAGGGCCCA)?source=Homo sapiens (human)?to=0&format=json
0.137 | 0.008 | count_done; http://172.18.8.71:7700/v1/refseq/query?q=(nt:GGATGCCTGACGAGGTGTAGCCTTT)?source=Homo sapiens (human)?to=0&format=json
0.147 | 0.010 | count_done; http://172.18.8.71:7700/v1/refseq/query?q=(nt:GCAACTTCCCTTATGGCATTAATCT)?source=Homo sapiens (human)?to=0&format=json
0.158 | 0.012 | count_done; http://172.18.8.71:7700/v1/refseq/query?q=(nt:GATAAGGACCAATGACAGCAAAGCA)?source=Homo sapiens (human)?to=0&format=json
0.169 | 0.011 | count_done; http://172.18.8.71:7700/v1/refseq/query?q=(nt:GAGACATTTTTGTAGGATGCCTGAC)?source=Homo sapiens (human)?to=0&format=json
0.179 | 0.010 | count_done; http://172.18.8.71:7700/v1/refseq/query?q=(nt:GAGACAGAATCCTGGACTCTCCAAA)?source=Homo sapiens (human)?to=0&format=json
0.190 | 0.011 | count_done; http://172.18.8.71:7700/v1/refseq/query?q=(nt:CTGCCCCCGCACAGAAATGCTGCAG)?source=Homo sapiens (human)?to=0&format=json
0.666 | 0.476 | search_done; http://172.18.8.71:7700/v1/refseq/query?q=(nt:TGTTTCTAACACGCTTGCAACTTCC)%26(nt:TGTAGCCTTTTATCTTGTTTCCGGA)%26(nt:TGAAAGGACCTTTTGTCACAGCACT)%26(nt:GTTTCCGGATGCATATTTATTACGA)%26(nt:GTAGGGCCTGCTCTGACAGGGCCCA)%26(nt:GGATGCCTGACGAGGTGTAGCCTTT)%26(nt:GCAACTTCCCTTATGGCATTAATCT)%26(nt:GATAAGGACCAATGACAGCAAAGCA)%26(nt:GAGACATTTTTGTAGGATGCCTGAC)%26(nt:GAGACAGAATCCTGGACTCTCCAAA)%26(nt:CTGCCCCCGCACAGAAATGCTGCAG)?source=Homo sapiens (human)?to=49?from=0?snippet=full_search?drilldown=source?get=accession,version,gi,length,symbol,synonym,geneid,division,source,definition&format=json
0.679 | 0.013 | cgi_end;

GGRNA ver.2 by @meso_cacase at DBCLS
This page is licensed under a Creative Commons Attribution 4.0 International License (CC BY 4.0).

If you use GGRNA in your work, please cite:
Naito Y, Bono H. (2012)
GGRNA: an ultrafast, transcript-oriented search engine for genes and transcripts.
Nucleic Acids Res., 40, W592-W596. [Full Text]