GGRNA ver.2 Help | Advanced search | Japanese    Previous release (v1)

2024-04-17 02:32:02, GGRNA : RefSeq release 222 (Jan, 2024)

Summary:

Results:

Matches are highlighted with green background. Overlapping matches are dark colored.

Homo sapiens ribosomal protein L41 (RPL41), transcript variant 1, mRNA. (561 bp)
to the yeast ribosomal protein YL41 JOURNAL Biochem Biophys Res Commun 187 (2), 901-906 (1992) PUBMED 1326959 ctctcggccttagcgccatttttttggaaacctctgcgccatgagagccaagtggaggaagaagcgaatgcgcaggctgaagcgcaaaagaagaaagatgaggcagaggtccaagtaaaccgctagcttgttgcaccgtggaggccacaggagcagaaacatggaatgccagacgctggggatgctggtacaagttgtgggactgcatgctactgtctagagcttgtctcaatggatctagaacttcatcgccctctgatcgccgatcacctctgagacccaccttgctcataaacaaaatgcccatgttggtcctctgccctggacctgtgacattctggactatttctgtgtttatttgtggccgagtgtaacaaccatataataaatcacctcttccgctgttttagctgaagaattaaatcatcttgtctattatgttttttatggttccatcgggtgggggttttctgtcattagagtttgccct...
position 172
Synonym: eL41; L41
NM_021104.2 - Homo sapiens (human) - NCBI - UCSC - RefEx(expression)
Homo sapiens ribosomal protein L41 (RPL41), transcript variant 2, mRNA. (676 bp)
ctctcggccttagcgccatttttttgggtgagtgttttttggttcctgcgttgggattccgtgtacaatccatagacatctgacctcggcacttagcatcatcacagcaaactaactgtagcctttctctctttccctgtagaaacctctgcgccatgagagccaagtggaggaagaagcgaatgcgcaggctgaagcgcaaaagaagaaagatgaggcagaggtccaagtaaaccgctagcttgttgcaccgtggaggccacaggagcagaaacatggaatgccagacgctggggatgctggtacaagttgtgggactgcatgctactgtctagagcttgtctcaatggatctagaacttcatcgccctctgatcgccgatcacctctgagacccaccttgctcataaacaaaatgcccatgttggtcctctgccctggacctgtgacattctggactatttctgtgtttatttgtggccgagtgtaacaaccatataataaatcacctcttccgctgttttagctgaagaattaaatcatcttgtctattatgttttttatggttccatcgggtgggggttttctgtcattagagttt...
position 287
Synonym: eL41; L41
NM_001035267.2 - Homo sapiens (human) - NCBI - UCSC - RefEx(expression)

Data Export:

Maximum 10000 results can be retrieved as Tab-delimited text or JSON format.

Debug Info:

Redirect URI : http://ggrna.dbcls.jp/hs/seq%3aGACGCTGGGGATGCTGGTACAAGTT
lang : en | div : | spe : hs | query_string : seq:GACGCTGGGGATGCTGGTACAAGTT | format : html | download : 

0.000 | 0.000 | search_start;
0.085 | 0.085 | count_done; http://172.18.8.71:7700/v1/refsub/query?q=(nt:GACGCTGGGGATGCTGGTACAAGTT)?source=Homo sapiens (human)?to=0&format=json
0.106 | 0.021 | search_done; http://172.18.8.71:7700/v1/refsub/query?q=(nt:GACGCTGGGGATGCTGGTACAAGTT)?source=Homo sapiens (human)?to=49?from=0?snippet=full_search?drilldown=source?get=accession,version,gi,length,symbol,synonym,geneid,division,source,definition&format=json
0.107 | 0.000 | cgi_end;

GGRNA ver.2 by @meso_cacase at DBCLS
This page is licensed under a Creative Commons Attribution 4.0 International License (CC BY 4.0).

If you use GGRNA in your work, please cite:
Naito Y, Bono H. (2012)
GGRNA: an ultrafast, transcript-oriented search engine for genes and transcripts.
Nucleic Acids Res., 40, W592-W596. [Full Text]