GGRNA ver.2 Help | Advanced search | Japanese    Previous release (v1)

2021-01-17 00:27:27, GGRNA : RefSeq release 203 (Nov, 2020)



Matches are highlighted with green background. Overlapping matches are dark colored.

Homo sapiens ribosomal protein L41 (RPL41), transcript variant 1, mRNA. (561 bp)
Res Commun 187 (2), 901-906 (1992) PUBMED 1326959 ctctcggccttagcgccatttttttggaaacctctgcgccatgagagccaagtggaggaagaagcgaatgcgcaggctgaagcgcaaaagaagaaagatgaggcagaggtccaagtaaaccgctagcttgttgcaccgtggaggccacaggagcagaaacatggaatgccagacgctggggatgctggtacaagttgtgggactgcatgctactgtctagagcttgtctcaatggatctagaacttcatcgccctctgatcgccgatcacctctgagacccaccttgctcataaacaaaatgcccatgttggtcctctgccctggacctgtgacattctggactatttctgtgtttatttgtggccgagtgtaacaaccatataataaatcacctcttccgctgttttagctgaagaattaaatcatcttgtctattatgttttttatggttccatcgggtgggggttttctgtcattagagtttgccctgtcactacctgtgctatggagggtatcaaagctataaaggcaacagcccgggttacgtgg...
position 113 127 156 172 190 231 254 275 295 321 349
Synonym: L41
NM_021104.2 - Homo sapiens (human) - NCBI - UCSC - RefEx(expression)
Homo sapiens ribosomal protein L41 (RPL41), transcript variant 2, mRNA. (676 bp)
position 228 242 271 287 305 346 369 390 410 436 464
Synonym: L41
NM_001035267.2 - Homo sapiens (human) - NCBI - UCSC - RefEx(expression)
PREDICTED: Homo sapiens RNA binding fox-1 homolog 2 (RBFOX2), transcript variant X23, mRNA. (9380 bp)
position 495 509 538 554 572 613 636 657 677 703 731
Synonym: dJ106I20.3; Fox-2; FOX2; fxh; HNRBP2; HRNBP2; RBM9; RTA
XM_024452190.1 - Homo sapiens (human) - NCBI - UCSC - RefEx(expression)

Data Export:

Maximum 10000 results can be retrieved as Tab-delimited text or JSON format.

Debug Info:

Redirect URI :
lang : en | div : | spe : hs | query_string : 201492_s_at | format : html | download :

0.000 | 0.000 | search_start;
0.091 | 0.091 | count_done; sapiens (human)?to=0&format=json
0.104 | 0.014 | count_done; sapiens (human)?to=0&format=json
0.117 | 0.013 | count_done; sapiens (human)?to=0&format=json
0.129 | 0.011 | count_done; sapiens (human)?to=0&format=json
0.140 | 0.011 | count_done; sapiens (human)?to=0&format=json
0.152 | 0.012 | count_done; sapiens (human)?to=0&format=json
0.163 | 0.011 | count_done; sapiens (human)?to=0&format=json
0.173 | 0.010 | count_done; sapiens (human)?to=0&format=json
0.184 | 0.010 | count_done; sapiens (human)?to=0&format=json
0.193 | 0.009 | count_done; sapiens (human)?to=0&format=json
0.203 | 0.010 | count_done; sapiens (human)?to=0&format=json
0.283 | 0.080 | search_done; sapiens (human)?to=49?from=0?snippet=full_search?drilldown=source?get=accession,version,gi,length,symbol,synonym,geneid,division,source,definition&format=json
0.285 | 0.002 | cgi_end;

GGRNA ver.2 by @meso_cacase at DBCLS
This page is licensed under a Creative Commons Attribution 4.0 International License (CC BY 4.0).

If you use GGRNA in your work, please cite:
Naito Y, Bono H. (2012)
GGRNA: an ultrafast, transcript-oriented search engine for genes and transcripts.
Nucleic Acids Res., 40, W592-W596. [Full Text]