GGRNA ver.2 Help | Advanced search | Japanese    Previous release (v1)

2021-04-23 23:50:27, GGRNA : RefSeq release 205 (Mar, 2021)

Summary:

Results:

Matches are highlighted with green background. Overlapping matches are dark colored.

Homo sapiens ribosomal protein L41 (RPL41), transcript variant 1, mRNA. (561 bp)
Res Commun 187 (2), 901-906 (1992) PUBMED 1326959 ctctcggccttagcgccatttttttggaaacctctgcgccatgagagccaagtggaggaagaagcgaatgcgcaggctgaagcgcaaaagaagaaagatgaggcagaggtccaagtaaaccgctagcttgttgcaccgtggaggccacaggagcagaaacatggaatgccagacgctggggatgctggtacaagttgtgggactgcatgctactgtctagagcttgtctcaatggatctagaacttcatcgccctctgatcgccgatcacctctgagacccaccttgctcataaacaaaatgcccatgttggtcctctgccctggacctgtgacattctggactatttctgtgtttatttgtggccgagtgtaacaaccatataataaatcacctcttccgctgttttagctgaagaattaaatcatcttgtctattatgttttttatggttccatcgggtgggggttttctgtcattagagtttgccctgtcactacctgtgctatggagggtatcaaagctataaaggcaacagcccgggttacgtgg...
position 113 127 156 172 190 231 254 275 295 321 349
Synonym: L41
NM_021104.2 - Homo sapiens (human) - NCBI - UCSC - RefEx(expression)
Homo sapiens ribosomal protein L41 (RPL41), transcript variant 2, mRNA. (676 bp)
tccgtgtacaatccatagacatctgacctcggcacttagcatcatcacagcaaactaactgtagcctttctctctttccctgtagaaacctctgcgccatgagagccaagtggaggaagaagcgaatgcgcaggctgaagcgcaaaagaagaaagatgaggcagaggtccaagtaaaccgctagcttgttgcaccgtggaggccacaggagcagaaacatggaatgccagacgctggggatgctggtacaagttgtgggactgcatgctactgtctagagcttgtctcaatggatctagaacttcatcgccctctgatcgccgatcacctctgagacccaccttgctcataaacaaaatgcccatgttggtcctctgccctggacctgtgacattctggactatttctgtgtttatttgtggccgagtgtaacaaccatataataaatcacctcttccgctgttttagctgaagaattaaatcatcttgtctattatgttttttatggttccatcgggtgggggttttctgtcattagagtttgccctgtcactacctgtgctatggagggtatcaaagctataaaggcaacagcccggg...
position 228 242 271 287 305 346 369 390 410 436 464
Synonym: L41
NM_001035267.2 - Homo sapiens (human) - NCBI - UCSC - RefEx(expression)
PREDICTED: Homo sapiens RNA binding fox-1 homolog 2 (RBFOX2), transcript variant X23, mRNA. (9380 bp)
cagcacggctgctttgaaaggtttatcatctatccgtttggtttatggagaaaaagaaaatggtaactcagcgccatttttttggaaacctctgtgccatgagagccaagtggaggaagaagcgaatgcgcaggctgaagcgcaaaagaagaaagatgaggcagaggtccaagtaaaccgctagcttgttgcaccgtggaggccacaggagcagaaacatggaatgccagacgctggggatgctggtacaagttgtgggactgcatgctactgtctagaacttgtctcaatggatctagaacttcatcgccctctgatcgccgatcacctctgagacccaccttgctcataaacaaaatgcccatgttggtcctctgccctggacctgtgacattctggactatttctgtgtttatttgtggccgagtgtaacaaccatataataaatcacctcttccgctgttttagctgaagaattaaaaaaaaaaaaagaaaagaaatactgctttattttttaaaaaaaatttacataaaagataaatcctgtttctggattctctttttgcttgggagatgatacttgcttaaccttagagccct...
position 495 509 538 554 572 613 636 657 677 703 731
Synonym: dJ106I20.3; Fox-2; FOX2; fxh; HNRBP2; HRNBP2; RBM9; RTA
XM_024452190.1 - Homo sapiens (human) - NCBI - UCSC - RefEx(expression)

Data Export:

Maximum 10000 results can be retrieved as Tab-delimited text or JSON format.

Debug Info:

Redirect URI : http://ggrna.dbcls.jp/hs/201492_s_at
lang : en | div : | spe : hs | query_string : 201492_s_at | format : html | download :

0.000 | 0.000 | search_start;
0.356 | 0.356 | count_done; http://172.18.8.71:7700/v1/refseq/query?q=(nt:GAGACCCACCTTGCTCATAAACAAA)?source=Homo sapiens (human)?to=0&format=json
0.371 | 0.015 | count_done; http://172.18.8.71:7700/v1/refseq/query?q=(nt:GACGCTGGGGATGCTGGTACAAGTT)?source=Homo sapiens (human)?to=0&format=json
0.383 | 0.012 | count_done; http://172.18.8.71:7700/v1/refseq/query?q=(nt:GAAACATGGAATGCCAGACGCTGGG)?source=Homo sapiens (human)?to=0&format=json
0.393 | 0.009 | count_done; http://172.18.8.71:7700/v1/refseq/query?q=(nt:CTTGTTGCACCGTGGAGGCCACAGG)?source=Homo sapiens (human)?to=0&format=json
0.401 | 0.009 | count_done; http://172.18.8.71:7700/v1/refseq/query?q=(nt:CTGTGTTTATTTGTGGCCGAGTGTA)?source=Homo sapiens (human)?to=0&format=json
0.413 | 0.011 | count_done; http://172.18.8.71:7700/v1/refseq/query?q=(nt:CTCTGATCGCCGATCACCTCTGAGA)?source=Homo sapiens (human)?to=0&format=json
0.425 | 0.012 | count_done; http://172.18.8.71:7700/v1/refseq/query?q=(nt:CCTGGACCTGTGACATTCTGGACTA)?source=Homo sapiens (human)?to=0&format=json
0.434 | 0.010 | count_done; http://172.18.8.71:7700/v1/refseq/query?q=(nt:ACAAGTTGTGGGACTGCATGCTACT)?source=Homo sapiens (human)?to=0&format=json
0.445 | 0.010 | count_done; http://172.18.8.71:7700/v1/refseq/query?q=(nt:ACAAAATGCCCATGTTGGTCCTCTG)?source=Homo sapiens (human)?to=0&format=json
0.455 | 0.010 | count_done; http://172.18.8.71:7700/v1/refseq/query?q=(nt:AATGGATCTAGAACTTCATCGCCCT)?source=Homo sapiens (human)?to=0&format=json
0.464 | 0.009 | count_done; http://172.18.8.71:7700/v1/refseq/query?q=(nt:AAGTAAACCGCTAGCTTGTTGCACC)?source=Homo sapiens (human)?to=0&format=json
0.544 | 0.080 | search_done; http://172.18.8.71:7700/v1/refseq/query?q=(nt:GAGACCCACCTTGCTCATAAACAAA)%26(nt:GACGCTGGGGATGCTGGTACAAGTT)%26(nt:GAAACATGGAATGCCAGACGCTGGG)%26(nt:CTTGTTGCACCGTGGAGGCCACAGG)%26(nt:CTGTGTTTATTTGTGGCCGAGTGTA)%26(nt:CTCTGATCGCCGATCACCTCTGAGA)%26(nt:CCTGGACCTGTGACATTCTGGACTA)%26(nt:ACAAGTTGTGGGACTGCATGCTACT)%26(nt:ACAAAATGCCCATGTTGGTCCTCTG)%26(nt:AATGGATCTAGAACTTCATCGCCCT)%26(nt:AAGTAAACCGCTAGCTTGTTGCACC)?source=Homo sapiens (human)?to=49?from=0?snippet=full_search?drilldown=source?get=accession,version,gi,length,symbol,synonym,geneid,division,source,definition&format=json
0.546 | 0.002 | cgi_end;

GGRNA ver.2 by @meso_cacase at DBCLS
This page is licensed under a Creative Commons Attribution 4.0 International License (CC BY 4.0).

If you use GGRNA in your work, please cite:
Naito Y, Bono H. (2012)
GGRNA: an ultrafast, transcript-oriented search engine for genes and transcripts.
Nucleic Acids Res., 40, W592-W596. [Full Text]