GGRNA ver.2 Help | Advanced search | Japanese    Previous release (v1)

2021-01-24 05:49:33, GGRNA : RefSeq release 203 (Nov, 2020)

Summary:

Results:

Matches are highlighted with green background. Overlapping matches are dark colored.

Homo sapiens ATPase Na+/K+ transporting subunit beta 1 (ATP1B1), mRNA. (2216 bp)
gggggtttgtcatgggggaactgccctttaaattttaagtgacactacagaaaaacacaaaaaggtgatgggttgtgttatgcttgtattgaatgctgtcttgacatctcttgccttgtcctccggtatgttctaaagctgtgtctgagatctggatctgcccatcactttggctagtgacagggctaattaatttgctttatacattttcttttactttccttttttcctttctggaggcatcacatgctggtgctgtgtctttatgaatgttttaaccattttcatggtggaagaattttatatttatgcagttgtacaattttatttttttctgcaagaaaaagtgtaatgtatgaaataaaccaaagtcacttgtttgaaaataaatctttattttgaactttataaaaagcaatgcagtaccccatagactggtgttaaatgttgtctacagtgcaaaatccatgttctaacatatgtaataattgccaggagtacagtgctcttgttgatcttgtattcagtcaggttaaaacaacggacaataaaagaatgaacaca
position 1716 1729 1743 1767 1774 1788 1796 1889 1904 2085 2166
Synonym: ATP1B
NM_001677.4 - Homo sapiens (human) - NCBI - UCSC - RefEx(expression)

Data Export:

Maximum 10000 results can be retrieved as Tab-delimited text or JSON format.

Debug Info:

Redirect URI : http://ggrna.dbcls.jp/hs/201243_s_at
lang : en | div : | spe : hs | query_string : 201243_s_at | format : html | download :

0.000 | 0.000 | search_start;
0.092 | 0.091 | count_done; http://172.18.8.71:7700/v1/refseq/query?q=(nt:TCTGAGATCTGGATCTGCCCATCAC)?source=Homo sapiens (human)?to=0&format=json
0.102 | 0.010 | count_done; http://172.18.8.71:7700/v1/refseq/query?q=(nt:TCCGGTATGTTCTAAAGCTGTGTCT)?source=Homo sapiens (human)?to=0&format=json
0.113 | 0.011 | count_done; http://172.18.8.71:7700/v1/refseq/query?q=(nt:GTTATGCTTGTATTGAATGCTGTCT)?source=Homo sapiens (human)?to=0&format=json
0.123 | 0.010 | count_done; http://172.18.8.71:7700/v1/refseq/query?q=(nt:GGTGCTGTGTCTTTATGAATGTTTT)?source=Homo sapiens (human)?to=0&format=json
0.133 | 0.010 | count_done; http://172.18.8.71:7700/v1/refseq/query?q=(nt:GGTGATGGGTTGTGTTATGCTTGTA)?source=Homo sapiens (human)?to=0&format=json
0.143 | 0.010 | count_done; http://172.18.8.71:7700/v1/refseq/query?q=(nt:GATCTTGTATTCAGTCAGGTTAAAA)?source=Homo sapiens (human)?to=0&format=json
0.155 | 0.012 | count_done; http://172.18.8.71:7700/v1/refseq/query?q=(nt:GAGGCATCACATGCTGGTGCTGTGT)?source=Homo sapiens (human)?to=0&format=json
0.166 | 0.011 | count_done; http://172.18.8.71:7700/v1/refseq/query?q=(nt:GACTGGTGTTAAATGTTGTCTACAG)?source=Homo sapiens (human)?to=0&format=json
0.176 | 0.010 | count_done; http://172.18.8.71:7700/v1/refseq/query?q=(nt:GAATGCTGTCTTGACATCTCTTGCC)?source=Homo sapiens (human)?to=0&format=json
0.186 | 0.010 | count_done; http://172.18.8.71:7700/v1/refseq/query?q=(nt:CTTGTCCTCCGGTATGTTCTAAAGC)?source=Homo sapiens (human)?to=0&format=json
0.196 | 0.010 | count_done; http://172.18.8.71:7700/v1/refseq/query?q=(nt:AAGCTGTGTCTGAGATCTGGATCTG)?source=Homo sapiens (human)?to=0&format=json
0.223 | 0.027 | search_done; http://172.18.8.71:7700/v1/refseq/query?q=(nt:TCTGAGATCTGGATCTGCCCATCAC)%26(nt:TCCGGTATGTTCTAAAGCTGTGTCT)%26(nt:GTTATGCTTGTATTGAATGCTGTCT)%26(nt:GGTGCTGTGTCTTTATGAATGTTTT)%26(nt:GGTGATGGGTTGTGTTATGCTTGTA)%26(nt:GATCTTGTATTCAGTCAGGTTAAAA)%26(nt:GAGGCATCACATGCTGGTGCTGTGT)%26(nt:GACTGGTGTTAAATGTTGTCTACAG)%26(nt:GAATGCTGTCTTGACATCTCTTGCC)%26(nt:CTTGTCCTCCGGTATGTTCTAAAGC)%26(nt:AAGCTGTGTCTGAGATCTGGATCTG)?source=Homo sapiens (human)?to=49?from=0?snippet=full_search?drilldown=source?get=accession,version,gi,length,symbol,synonym,geneid,division,source,definition&format=json
0.224 | 0.001 | cgi_end;

GGRNA ver.2 by @meso_cacase at DBCLS
This page is licensed under a Creative Commons Attribution 4.0 International License (CC BY 4.0).

If you use GGRNA in your work, please cite:
Naito Y, Bono H. (2012)
GGRNA: an ultrafast, transcript-oriented search engine for genes and transcripts.
Nucleic Acids Res., 40, W592-W596. [Full Text]