GGRNA ver.2 Help | Advanced search | Japanese    Previous release (v1)

2021-01-17 00:38:03, GGRNA : RefSeq release 203 (Nov, 2020)

Summary:

Results:

Matches are highlighted with green background. Overlapping matches are dark colored.

Homo sapiens NADH:ubiquinone oxidoreductase subunit B8 (NDUFB8), transcript variant 3, mRNA; nuclear gene for mitochondrial product. (667 bp)
gctcacagcatgagagagatccatggtatagctgggaccagccgggcctgaggttgaactggggtgaaccgatgcactggcacctagacatgtacaacaggaaccgtgtggatacatcccccacacctgtttcttggcatgtcatgtgtatgcagctcttcggtttcctggctttcatgatattcatgtgctgggtgggggacgtgtaccctgtctaccagcctgtgggaccaaagcagtatccttacaataatctgtacctggaacgaggcggtgatccctccaaagaaccagagcgggtggttcactatgagatctgaggaggcttcgtgggcttttgggtcctctaactaggactccctcattcctagaaatttaaccttaatgaaatccctaataaaactcagtgctgtgttatttgtgcctcaaaaaaaaaaaaaaaaaa
position 461 479 494 498 513 519 534 538 561 568 576
Synonym: ASHI; CI-ASHI; MC1DN32
NM_001284368.1 - Homo sapiens (human) - NCBI - UCSC - RefEx(expression)
Homo sapiens NADH:ubiquinone oxidoreductase subunit B8 (NDUFB8), transcript variant 1, mRNA; nuclear gene for mitochondrial product. (678 bp)
gctcacagcatgagagagatccatggtatagctgggaccagccgggcctgaggttgaactggggtgaaccgatgcactggcacctagacatgtacaacaggaaccgtgtggatacatcccccacacctgtttcttggcatgtcatgtgtatgcagctcttcggtttcctggctttcatgatattcatgtgctgggtgggggacgtgtaccctgtctaccagcctgtgggaccaaagcagtatccttacaataatctgtacctggaacgaggcggtgatccctccaaagaaccagagcgggtggttcactatgagatctgaggaggcttcgtgggcttttgggtcctctaactaggactccctcattcctagaaatttaaccttaatgaaatccctaataaaactcagtgctgtgtta
position 500 518 533 537 552 558 573 577 600 607 615
Synonym: ASHI; CI-ASHI; MC1DN32
NM_005004.4 - Homo sapiens (human) - NCBI - UCSC - RefEx(expression)
Homo sapiens NADH:ubiquinone oxidoreductase subunit B8 (NDUFB8), transcript variant 2, mRNA; nuclear gene for mitochondrial product. (888 bp)
ctgtctaccagcctgtgtgtaggcaccacttctcttacaatttaggctttctctctgccttgggctgagtgaggaagaggagtgctgttcctgccttcctagcccagctgggtctgaccagaggctactgtgtacccatttaccatgcgtgattgttaactcagagtggggtgtagccaggtattgactgaatgtatgttcttgctgacctgtgtttttttctgtagggaccaaagcagtatccttacaataatctgtacctggaacgaggcggtgatccctccaaagaaccagagcgggtggttcactatgagatctgaggaggcttcgtgggcttttgggtcctctaactaggactccctcattcctagaaatttaaccttaatgaaatccctaataaaactcagtgctgtgtta
position 710 728 743 747 762 768 783 787 810 817 825
Synonym: ASHI; CI-ASHI; MC1DN32
NM_001284367.2 - Homo sapiens (human) - NCBI - UCSC - RefEx(expression)

Data Export:

Maximum 10000 results can be retrieved as Tab-delimited text or JSON format.

Debug Info:

Redirect URI : http://ggrna.dbcls.jp/hs/201227_s_at
lang : en | div : | spe : hs | query_string : 201227_s_at | format : html | download :

0.000 | 0.000 | search_start;
0.084 | 0.084 | count_done; http://172.18.8.71:7700/v1/refseq/query?q=(nt:TGGGTCCTCTAACTAGGACTCCCTC)?source=Homo sapiens (human)?to=0&format=json
0.094 | 0.010 | count_done; http://172.18.8.71:7700/v1/refseq/query?q=(nt:TCTGAGGAGGCTTCGTGGGCTTTTG)?source=Homo sapiens (human)?to=0&format=json
0.105 | 0.010 | count_done; http://172.18.8.71:7700/v1/refseq/query?q=(nt:TCTAACTAGGACTCCCTCATTCCTA)?source=Homo sapiens (human)?to=0&format=json
0.115 | 0.010 | count_done; http://172.18.8.71:7700/v1/refseq/query?q=(nt:GTATCCTTACAATAATCTGTACCTG)?source=Homo sapiens (human)?to=0&format=json
0.124 | 0.009 | count_done; http://172.18.8.71:7700/v1/refseq/query?q=(nt:GTACCTGGAACGAGGCGGTGATCCC)?source=Homo sapiens (human)?to=0&format=json
0.134 | 0.010 | count_done; http://172.18.8.71:7700/v1/refseq/query?q=(nt:GGACTCCCTCATTCCTAGAAATTTA)?source=Homo sapiens (human)?to=0&format=json
0.145 | 0.010 | count_done; http://172.18.8.71:7700/v1/refseq/query?q=(nt:GATCCCTCCAAAGAACCAGAGCGGG)?source=Homo sapiens (human)?to=0&format=json
0.157 | 0.012 | count_done; http://172.18.8.71:7700/v1/refseq/query?q=(nt:GAGATCTGAGGAGGCTTCGTGGGCT)?source=Homo sapiens (human)?to=0&format=json
0.168 | 0.011 | count_done; http://172.18.8.71:7700/v1/refseq/query?q=(nt:CGGTGATCCCTCCAAAGAACCAGAG)?source=Homo sapiens (human)?to=0&format=json
0.178 | 0.010 | count_done; http://172.18.8.71:7700/v1/refseq/query?q=(nt:CGGGTGGTTCACTATGAGATCTGAG)?source=Homo sapiens (human)?to=0&format=json
0.188 | 0.010 | count_done; http://172.18.8.71:7700/v1/refseq/query?q=(nt:CCAGAGCGGGTGGTTCACTATGAGA)?source=Homo sapiens (human)?to=0&format=json
0.231 | 0.042 | search_done; http://172.18.8.71:7700/v1/refseq/query?q=(nt:TGGGTCCTCTAACTAGGACTCCCTC)%26(nt:TCTGAGGAGGCTTCGTGGGCTTTTG)%26(nt:TCTAACTAGGACTCCCTCATTCCTA)%26(nt:GTATCCTTACAATAATCTGTACCTG)%26(nt:GTACCTGGAACGAGGCGGTGATCCC)%26(nt:GGACTCCCTCATTCCTAGAAATTTA)%26(nt:GATCCCTCCAAAGAACCAGAGCGGG)%26(nt:GAGATCTGAGGAGGCTTCGTGGGCT)%26(nt:CGGTGATCCCTCCAAAGAACCAGAG)%26(nt:CGGGTGGTTCACTATGAGATCTGAG)%26(nt:CCAGAGCGGGTGGTTCACTATGAGA)?source=Homo sapiens (human)?to=49?from=0?snippet=full_search?drilldown=source?get=accession,version,gi,length,symbol,synonym,geneid,division,source,definition&format=json
0.233 | 0.002 | cgi_end;

GGRNA ver.2 by @meso_cacase at DBCLS
This page is licensed under a Creative Commons Attribution 4.0 International License (CC BY 4.0).

If you use GGRNA in your work, please cite:
Naito Y, Bono H. (2012)
GGRNA: an ultrafast, transcript-oriented search engine for genes and transcripts.
Nucleic Acids Res., 40, W592-W596. [Full Text]