GGRNA ver.2 Help | Advanced search | Japanese    Previous release (v1)

2021-01-24 04:54:55, GGRNA : RefSeq release 203 (Nov, 2020)

Summary:

Results:

Matches are highlighted with green background. Overlapping matches are dark colored.

Homo sapiens cystatin B (CSTB), mRNA. (588 bp)
JOURNAL Acta Histochem 82 (1), 5-18 (1987) PUBMED 3122506 REMARK Review article gccgagtcccctcgccagattccctccgtcgccgccaagatgatgtgcggggcgccctccgccacgcagccggccaccgccgagacccagcacatcgccgaccaggtgaggtcccagcttgaagagaaagaaaacaagaagttccctgtgtttaaggccgtgtcattcaagagccaggtggtcgcggggacaaactacttcatcaaggtgcacgtcggcgacgaggacttcgtacacctgcgagtgttccaatctctccctcatgaaaacaagcccttgaccttatctaactaccagaccaacaaagccaagcatgatgagctgacctatttctgatcctgactttggacaaggcccttcagccagaagactgacaaagtcatcctccgtctaccagagcgtgcacttgtgatcctaaaataagcttcatctccgggctgtgccccttggggtggaaggggcaggattctgcagctgcttttgcatttctcttcctaaatttcattgtgttgatttcttt...
position 25 101 141 157 182 201 232 252 279 316 389
Synonym: CPI-B; CST6; EPM1; EPM1A; PME; STFB; ULD
NM_000100.4 - Homo sapiens (human) - NCBI - UCSC - RefEx(expression)

Data Export:

Maximum 10000 results can be retrieved as Tab-delimited text or JSON format.

Debug Info:

Redirect URI : http://ggrna.dbcls.jp/hs/201201_at
lang : en | div : | spe : hs | query_string : 201201_at | format : html | download :

0.000 | 0.000 | search_start;
0.091 | 0.091 | count_done; http://172.18.8.71:7700/v1/refseq/query?q=(nt:TCGCGGGGACAAACTACTTCATCAA)?source=Homo sapiens (human)?to=0&format=json
0.103 | 0.012 | count_done; http://172.18.8.71:7700/v1/refseq/query?q=(nt:TCCGTCGCCGCCAAGATGATGTGCG)?source=Homo sapiens (human)?to=0&format=json
0.113 | 0.010 | count_done; http://172.18.8.71:7700/v1/refseq/query?q=(nt:GTTCCCTGTGTTTAAGGCCGTGTCA)?source=Homo sapiens (human)?to=0&format=json
0.123 | 0.010 | count_done; http://172.18.8.71:7700/v1/refseq/query?q=(nt:GTCTACCAGAGCGTGCACTTGTGAT)?source=Homo sapiens (human)?to=0&format=json
0.421 | 0.298 | count_done; http://172.18.8.71:7700/v1/refseq/query?q=(nt:GTACACCTGCGAGTGTTCCAATCTC)?source=Homo sapiens (human)?to=0&format=json
0.434 | 0.013 | count_done; http://172.18.8.71:7700/v1/refseq/query?q=(nt:GCCGTGTCATTCAAGAGCCAGGTGG)?source=Homo sapiens (human)?to=0&format=json
0.444 | 0.010 | count_done; http://172.18.8.71:7700/v1/refseq/query?q=(nt:GATGAGCTGACCTATTTCTGATCCT)?source=Homo sapiens (human)?to=0&format=json
0.455 | 0.010 | count_done; http://172.18.8.71:7700/v1/refseq/query?q=(nt:GACCTTATCTAACTACCAGACCAAC)?source=Homo sapiens (human)?to=0&format=json
0.466 | 0.012 | count_done; http://172.18.8.71:7700/v1/refseq/query?q=(nt:CATCAAGGTGCACGTCGGCGACGAG)?source=Homo sapiens (human)?to=0&format=json
0.476 | 0.010 | count_done; http://172.18.8.71:7700/v1/refseq/query?q=(nt:ATCTCTCCCTCATGAAAACAAGCCC)?source=Homo sapiens (human)?to=0&format=json
0.487 | 0.011 | count_done; http://172.18.8.71:7700/v1/refseq/query?q=(nt:ACCAGGTGAGGTCCCAGCTTGAAGA)?source=Homo sapiens (human)?to=0&format=json
0.512 | 0.025 | search_done; http://172.18.8.71:7700/v1/refseq/query?q=(nt:TCGCGGGGACAAACTACTTCATCAA)%26(nt:TCCGTCGCCGCCAAGATGATGTGCG)%26(nt:GTTCCCTGTGTTTAAGGCCGTGTCA)%26(nt:GTCTACCAGAGCGTGCACTTGTGAT)%26(nt:GTACACCTGCGAGTGTTCCAATCTC)%26(nt:GCCGTGTCATTCAAGAGCCAGGTGG)%26(nt:GATGAGCTGACCTATTTCTGATCCT)%26(nt:GACCTTATCTAACTACCAGACCAAC)%26(nt:CATCAAGGTGCACGTCGGCGACGAG)%26(nt:ATCTCTCCCTCATGAAAACAAGCCC)%26(nt:ACCAGGTGAGGTCCCAGCTTGAAGA)?source=Homo sapiens (human)?to=49?from=0?snippet=full_search?drilldown=source?get=accession,version,gi,length,symbol,synonym,geneid,division,source,definition&format=json
0.513 | 0.001 | cgi_end;

GGRNA ver.2 by @meso_cacase at DBCLS
This page is licensed under a Creative Commons Attribution 4.0 International License (CC BY 4.0).

If you use GGRNA in your work, please cite:
Naito Y, Bono H. (2012)
GGRNA: an ultrafast, transcript-oriented search engine for genes and transcripts.
Nucleic Acids Res., 40, W592-W596. [Full Text]