GGRNA ver.2 Help | Advanced search | Japanese    Previous release (v1)

2021-10-17 16:05:11, GGRNA : RefSeq release 207 (Jul, 2021)

Summary:

Results:

Matches are highlighted with green background. Overlapping matches are dark colored.

PREDICTED: Homo sapiens inositol 1,4,5-trisphosphate receptor type 3 (ITPR3), transcript variant X1, mRNA. (8662 bp)
acccacccaggctttgaagagcatggagggggagcctcagagctgacagtcctgcttagagcccttaaaaagacttgaaagttcactgggactcagtttaccttaatgccttagcagaagataaatcctacctagagacctttgttccttaaagcaataactgacaactctttgtagtcctccttgtgggtagttaagagtggggtcacccctttaactccaagcactacattttggcggctgccggcctctgggggaggtggcagttatgctgttactagtgattttagggctttgttatttaacttatttcaagggtgctgtgctcagccctgcccatggctgtgcagctccctccgtgcctcagatctgctgtagccagtgcagacctcactgtcgtgtccatgccacccccggcatggctccaggtggcctggtgactccatgatggacgatcttgctcccaggacctgcctcttcccaggcttcctggggaagagttgtacgcccaggcaacaagggctgagctgcgcttgcgtggctgtttcatgaccgcttgtttttctccttttggtgtaatgttttacaaatcctttggcc...
position 8062 8105 8138 8175 8271 8376 8388 8439 8459 8508 8548
Synonym: IP3R; IP3R3
XM_011514577.3 - Homo sapiens (human) - NCBI - UCSC - RefEx(expression)
Homo sapiens inositol 1,4,5-trisphosphate receptor type 3 (ITPR3), mRNA. (9079 bp)
acccacccaggctttgaagagcatggagggggagcctcagagctgacagtcctgcttagagcccttaaaaagacttgaaagttcactgggactcagtttaccttaatgccttagcagaagataaatcctacctagagacctttgttccttaaagcaataactgacaactctttgtagtcctccttgtgggtagttaagagtggggtcacccctttaactccaagcactacattttggcggctgccggcctctgggggaggtggcagttatgctgttactagtgattttagggctttgttatttaacttatttcaagggtgctgtgctcagccctgcccatggctgtgcagctccctccgtgcctcagatctgctgtagccagtgcagacctcactgtcgtgtccatgccacccccggcatggctccaggtggcctggtgactccatgatggacgatcttgctcccaggacctgcctcttcccaggcttcctggggaagagttgtacgcccaggcaacaagggctgagctgcgcttgcgtggctgtttcatgaccgcttgtttttctccttttggtgtaatgttttacaaatcctttggcc...
position 8479 8522 8555 8592 8688 8793 8805 8856 8876 8925 8965
Synonym: IP3R; IP3R3
NM_002224.4 - Homo sapiens (human) - NCBI - UCSC - RefEx(expression)

Data Export:

Maximum 10000 results can be retrieved as Tab-delimited text or JSON format.

Debug Info:

Redirect URI : http://ggrna.dbcls.jp/hs/201189_s_at
lang : en | div : | spe : hs | query_string : 201189_s_at | format : html | download :

0.000 | 0.000 | search_start;
0.095 | 0.095 | count_done; http://172.18.8.71:7700/v1/refseq/query?q=(nt:TGCCTCAGATCTGCTGTAGCCAGTG)?source=Homo sapiens (human)?to=0&format=json
0.105 | 0.010 | count_done; http://172.18.8.71:7700/v1/refseq/query?q=(nt:TAAATCCTACCTAGAGACCTTTGTT)?source=Homo sapiens (human)?to=0&format=json
0.117 | 0.012 | count_done; http://172.18.8.71:7700/v1/refseq/query?q=(nt:GGGGAAGAGTTGTACGCCCAGGCAA)?source=Homo sapiens (human)?to=0&format=json
0.128 | 0.011 | count_done; http://172.18.8.71:7700/v1/refseq/query?q=(nt:GGGAGGTGGCAGTTATGCTGTTACT)?source=Homo sapiens (human)?to=0&format=json
0.141 | 0.013 | count_done; http://172.18.8.71:7700/v1/refseq/query?q=(nt:GGACTCAGTTTACCTTAATGCCTTA)?source=Homo sapiens (human)?to=0&format=json
0.152 | 0.012 | count_done; http://172.18.8.71:7700/v1/refseq/query?q=(nt:GCTTGCGTGGCTGTTTCATGACCGC)?source=Homo sapiens (human)?to=0&format=json
0.330 | 0.177 | count_done; http://172.18.8.71:7700/v1/refseq/query?q=(nt:GCTGTAGCCAGTGCAGACCTCACTG)?source=Homo sapiens (human)?to=0&format=json
0.340 | 0.010 | count_done; http://172.18.8.71:7700/v1/refseq/query?q=(nt:CTCCAGGTGGCCTGGTGACTCCATG)?source=Homo sapiens (human)?to=0&format=json
0.352 | 0.012 | count_done; http://172.18.8.71:7700/v1/refseq/query?q=(nt:CCATGATGGACGATCTTGCTCCCAG)?source=Homo sapiens (human)?to=0&format=json
0.363 | 0.011 | count_done; http://172.18.8.71:7700/v1/refseq/query?q=(nt:ACAGTCCTGCTTAGAGCCCTTAAAA)?source=Homo sapiens (human)?to=0&format=json
0.372 | 0.009 | count_done; http://172.18.8.71:7700/v1/refseq/query?q=(nt:AACTGACAACTCTTTGTAGTCCTCC)?source=Homo sapiens (human)?to=0&format=json
0.723 | 0.350 | search_done; http://172.18.8.71:7700/v1/refseq/query?q=(nt:TGCCTCAGATCTGCTGTAGCCAGTG)%26(nt:TAAATCCTACCTAGAGACCTTTGTT)%26(nt:GGGGAAGAGTTGTACGCCCAGGCAA)%26(nt:GGGAGGTGGCAGTTATGCTGTTACT)%26(nt:GGACTCAGTTTACCTTAATGCCTTA)%26(nt:GCTTGCGTGGCTGTTTCATGACCGC)%26(nt:GCTGTAGCCAGTGCAGACCTCACTG)%26(nt:CTCCAGGTGGCCTGGTGACTCCATG)%26(nt:CCATGATGGACGATCTTGCTCCCAG)%26(nt:ACAGTCCTGCTTAGAGCCCTTAAAA)%26(nt:AACTGACAACTCTTTGTAGTCCTCC)?source=Homo sapiens (human)?to=49?from=0?snippet=full_search?drilldown=source?get=accession,version,gi,length,symbol,synonym,geneid,division,source,definition&format=json
0.724 | 0.002 | cgi_end;

GGRNA ver.2 by @meso_cacase at DBCLS
This page is licensed under a Creative Commons Attribution 4.0 International License (CC BY 4.0).

If you use GGRNA in your work, please cite:
Naito Y, Bono H. (2012)
GGRNA: an ultrafast, transcript-oriented search engine for genes and transcripts.
Nucleic Acids Res., 40, W592-W596. [Full Text]