GGRNA ver.2 Help | Advanced search | Japanese    Previous release (v1)

2021-01-17 00:33:13, GGRNA : RefSeq release 203 (Nov, 2020)

Summary:

Results:

Matches are highlighted with green background. Overlapping matches are dark colored.

Homo sapiens phosphoglycerate mutase 1 (PGAM1), transcript variant 2, mRNA. (1657 bp)
tactaaggactttggggaggaaccatgctaagccatgaccagtgaggagaagcaacagagcctgtctgtccccatgagcggagtctgtcctctgctcttctgcagtcaggtcactgcctactgcctgggggctctagtcattccagtggaagacgaatgtaacctgcgtggtgatgtgacaactgtttcctccctgaccccagaggatctggctctaggttgggatcaatcctgaatttcgttatgtgttaatttacttttattaaaaaagtatagtatatataatacaaaacaataacccttctggggtttcttgtggcggttgaaatagtcccacatgtggtcatcagaaaataagccattcctcataccaatataggatcagctccttgacctctgaggggcaggagtgcttcctggtgtgtgtattagaatcccttcctgccttgtttcatggcagtgaaatgcctcttggtcctgtccaagtgtatctttcactgatttctgaatcatgttctagttgcttgaccctgccacatgggtccagtgttcatctgagcataactgtactaaatcctttttccatatcagtataataaa...
position 1057 1162 1207 1234 1356 1412 1457 1496 1547 1562 1597
Synonym: HEL-S-35; PGAM-B; PGAMA
NM_001317079.2 - Homo sapiens (human) - NCBI - UCSC - RefEx(expression)
Homo sapiens phosphoglycerate mutase 1 (PGAM1), transcript variant 1, mRNA. (1802 bp)
tactaaggactttggggaggaaccatgctaagccatgaccagtgaggagaagcaacagagcctgtctgtccccatgagcggagtctgtcctctgctcttctgcagtcaggtcactgcctactgcctgggggctctagtcattccagtggaagacgaatgtaacctgcgtggtgatgtgacaactgtttcctccctgaccccagaggatctggctctaggttgggatcaatcctgaatttcgttatgtgttaatttacttttattaaaaaagtatagtatatataatacaaaacaataacccttctggggtttcttgtggcggttgaaatagtcccacatgtggtcatcagaaaataagccattcctcataccaatataggatcagctccttgacctctgaggggcaggagtgcttcctggtgtgtgtattagaatcccttcctgccttgtttcatggcagtgaaatgcctcttggtcctgtccaagtgtatctttcactgatttctgaatcatgttctagttgcttgaccctgccacatgggtccagtgttcatctgagcataactgtactaaatcctttttccatatcagtataataaa...
position 1202 1307 1352 1379 1501 1557 1602 1641 1692 1707 1742
Synonym: HEL-S-35; PGAM-B; PGAMA
NM_002629.4 - Homo sapiens (human) - NCBI - UCSC - RefEx(expression)

Data Export:

Maximum 10000 results can be retrieved as Tab-delimited text or JSON format.

Debug Info:

Redirect URI : http://ggrna.dbcls.jp/hs/200886_s_at
lang : en | div : | spe : hs | query_string : 200886_s_at | format : html | download :

0.000 | 0.000 | search_start;
0.138 | 0.138 | count_done; http://172.18.8.71:7700/v1/refseq/query?q=(nt:TGGTGATGTGACAACTGTTTCCTCC)?source=Homo sapiens (human)?to=0&format=json
0.148 | 0.010 | count_done; http://172.18.8.71:7700/v1/refseq/query?q=(nt:GGTGTGTGTATTAGAATCCCTTCCT)?source=Homo sapiens (human)?to=0&format=json
0.160 | 0.012 | count_done; http://172.18.8.71:7700/v1/refseq/query?q=(nt:GGCGGTTGAAATAGTCCCACATGTG)?source=Homo sapiens (human)?to=0&format=json
0.170 | 0.010 | count_done; http://172.18.8.71:7700/v1/refseq/query?q=(nt:GGAACCATGCTAAGCCATGACCAGT)?source=Homo sapiens (human)?to=0&format=json
0.198 | 0.029 | count_done; http://172.18.8.71:7700/v1/refseq/query?q=(nt:GCATAACTGTACTAAATCCTTTTTC)?source=Homo sapiens (human)?to=0&format=json
0.209 | 0.010 | count_done; http://172.18.8.71:7700/v1/refseq/query?q=(nt:GACCCCAGAGGATCTGGCTCTAGGT)?source=Homo sapiens (human)?to=0&format=json
0.220 | 0.011 | count_done; http://172.18.8.71:7700/v1/refseq/query?q=(nt:CTTGACCCTGCCACATGGGTCCAGT)?source=Homo sapiens (human)?to=0&format=json
0.230 | 0.011 | count_done; http://172.18.8.71:7700/v1/refseq/query?q=(nt:CCTGGGGGCTCTAGTCATTCCAGTG)?source=Homo sapiens (human)?to=0&format=json
0.242 | 0.011 | count_done; http://172.18.8.71:7700/v1/refseq/query?q=(nt:CAGTGAAATGCCTCTTGGTCCTGTC)?source=Homo sapiens (human)?to=0&format=json
0.252 | 0.010 | count_done; http://172.18.8.71:7700/v1/refseq/query?q=(nt:ATCATGTTCTAGTTGCTTGACCCTG)?source=Homo sapiens (human)?to=0&format=json
0.330 | 0.079 | count_done; http://172.18.8.71:7700/v1/refseq/query?q=(nt:ATATAGGATCAGCTCCTTGACCTCT)?source=Homo sapiens (human)?to=0&format=json
0.368 | 0.038 | search_done; http://172.18.8.71:7700/v1/refseq/query?q=(nt:TGGTGATGTGACAACTGTTTCCTCC)%26(nt:GGTGTGTGTATTAGAATCCCTTCCT)%26(nt:GGCGGTTGAAATAGTCCCACATGTG)%26(nt:GGAACCATGCTAAGCCATGACCAGT)%26(nt:GCATAACTGTACTAAATCCTTTTTC)%26(nt:GACCCCAGAGGATCTGGCTCTAGGT)%26(nt:CTTGACCCTGCCACATGGGTCCAGT)%26(nt:CCTGGGGGCTCTAGTCATTCCAGTG)%26(nt:CAGTGAAATGCCTCTTGGTCCTGTC)%26(nt:ATCATGTTCTAGTTGCTTGACCCTG)%26(nt:ATATAGGATCAGCTCCTTGACCTCT)?source=Homo sapiens (human)?to=49?from=0?snippet=full_search?drilldown=source?get=accession,version,gi,length,symbol,synonym,geneid,division,source,definition&format=json
0.369 | 0.001 | cgi_end;

GGRNA ver.2 by @meso_cacase at DBCLS
This page is licensed under a Creative Commons Attribution 4.0 International License (CC BY 4.0).

If you use GGRNA in your work, please cite:
Naito Y, Bono H. (2012)
GGRNA: an ultrafast, transcript-oriented search engine for genes and transcripts.
Nucleic Acids Res., 40, W592-W596. [Full Text]