GGRNA ver.2 Help | Advanced search | Japanese    Previous release (v1)

2021-01-16 23:55:20, GGRNA : RefSeq release 203 (Nov, 2020)

Summary:

Results:

Matches are highlighted with green background. Overlapping matches are dark colored.

Homo sapiens ribosomal protein L32 (RPL32), transcript variant 2, mRNA. (1767 bp)
cagtgttcagtccctgggcaggaaagcctccttccaggattcttcctcacctggggccgcttcttccccaaaaggcatcatggccgccctcagaccccttgtgaagcccaagatcgtcaaaaagagaaccaagaagttcatccggcaccagtcagaccgatatgtcaaaattaagcgtaactggcggaaacccagaggcattgacaacagggttcgtagaagattcaagggccagatcttgatgcccaacattggttatggaagcaacaaaaaaacaaagcacatgctgcccagtggcttccggaagttcctggtccacaacgtcaaggagctggaagtgctgctgatgtgcaacaaatcttactgtgccgagatcgctcacaatgtttcctccaagaaccgcaaagccatcgtggaaagagctgcccaactggccatcagagtcaccaaccccaatgccaggctgcgcagtgaagaaaatgagtaggcagctcatgtgcacgttttctgtttaaataaatgtaaaaactgccatctggcatcttccttccttgattttaagtcttcagcttcttggccaacttagtttgccacagagat...
position 208 252 345 388 404 422 474 492 521 567 598
Synonym: L32; PP9932
NM_001007073.1 - Homo sapiens (human) - NCBI - UCSC - RefEx(expression)
Homo sapiens ribosomal protein L32 (RPL32), transcript variant 3, mRNA. (1787 bp)
cagtgttcagtccctgggcaggaaagcctccttccaggattcttcctcacctggggccgcttcttccccaaaaggcatcatggccgccctcagaccccttgtgaagcccaagatcgtcaaaaagagaaccaagaagttcatccggcaccagtcagaccgatatgtcaaaattaagcgtaactggcggaaacccagaggcattgacaacagggttcgtagaagattcaagggccagatcttgatgcccaacattggttatggaagcaacaaaaaaacaaagcacatgctgcccagtggcttccggaagttcctggtccacaacgtcaaggagctggaagtgctgctgatgtgcaacaaatcttactgtgccgagatcgctcacaatgtttcctccaagaaccgcaaagccatcgtggaaagagctgcccaactggccatcagagtcaccaaccccaatgccaggctgcgcagtgaagaaaatgagtaggcagctcatgtgcacgttttctgtttaaataaatgtaaaaactgccatctggcatcttccttccttgattttaagtcttcagcttcttggccaacttagtttgccacagagat...
position 228 272 365 408 424 442 494 512 541 587 618
Synonym: L32; PP9932
NM_001007074.1 - Homo sapiens (human) - NCBI - UCSC - RefEx(expression)
Homo sapiens ribosomal protein L32 (RPL32), transcript variant 1, mRNA. (2094 bp)
agcccttgcgcgccaccgtcccttctctcttcctcggcgctgcctacggaggtggcagccatctccttctcggcatcatggccgccctcagaccccttgtgaagcccaagatcgtcaaaaagagaaccaagaagttcatccggcaccagtcagaccgatatgtcaaaattaagcgtaactggcggaaacccagaggcattgacaacagggttcgtagaagattcaagggccagatcttgatgcccaacattggttatggaagcaacaaaaaaacaaagcacatgctgcccagtggcttccggaagttcctggtccacaacgtcaaggagctggaagtgctgctgatgtgcaacaaatcttactgtgccgagatcgctcacaatgtttcctccaagaaccgcaaagccatcgtggaaagagctgcccaactggccatcagagtcaccaaccccaatgccaggctgcgcagtgaagaaaatgagtaggcagctcatgtgcacgttttctgtttaaataaatgtaaaaactgccatctggcatcttccttccttgattttaagtcttcagcttcttggccaacttagtttgccacagagattg...
position 92 136 229 272 288 306 358 376 405 451 482
Synonym: L32; PP9932
NM_000994.4 - Homo sapiens (human) - NCBI - UCSC - RefEx(expression)

Data Export:

Maximum 10000 results can be retrieved as Tab-delimited text or JSON format.

Debug Info:

Redirect URI : http://ggrna.dbcls.jp/hs/200674_s_at
lang : en | div : | spe : hs | query_string : 200674_s_at | format : html | download :

0.000 | 0.000 | search_start;
0.088 | 0.088 | count_done; http://172.18.8.71:7700/v1/refseq/query?q=(nt:TTCCTGGTCCACAACGTCAAGGAGC)?source=Homo sapiens (human)?to=0&format=json
0.099 | 0.011 | count_done; http://172.18.8.71:7700/v1/refseq/query?q=(nt:TCATCCGGCACCAGTCAGACCGATA)?source=Homo sapiens (human)?to=0&format=json
0.111 | 0.012 | count_done; http://172.18.8.71:7700/v1/refseq/query?q=(nt:GTAGGCAGCTCATGTGCACGTTTTC)?source=Homo sapiens (human)?to=0&format=json
0.123 | 0.012 | count_done; http://172.18.8.71:7700/v1/refseq/query?q=(nt:GCCATCGTGGAAAGAGCTGCCCAAC)?source=Homo sapiens (human)?to=0&format=json
0.134 | 0.011 | count_done; http://172.18.8.71:7700/v1/refseq/query?q=(nt:GCCAGATCTTGATGCCCAACATTGG)?source=Homo sapiens (human)?to=0&format=json
0.193 | 0.059 | count_done; http://172.18.8.71:7700/v1/refseq/query?q=(nt:CTTACTGTGCCGAGATCGCTCACAA)?source=Homo sapiens (human)?to=0&format=json
0.204 | 0.011 | count_done; http://172.18.8.71:7700/v1/refseq/query?q=(nt:CTCACAATGTTTCCTCCAAGAACCG)?source=Homo sapiens (human)?to=0&format=json
0.231 | 0.027 | count_done; http://172.18.8.71:7700/v1/refseq/query?q=(nt:CCCAGTGGCTTCCGGAAGTTCCTGG)?source=Homo sapiens (human)?to=0&format=json
0.251 | 0.020 | count_done; http://172.18.8.71:7700/v1/refseq/query?q=(nt:CCAATGCCAGGCTGCGCAGTGAAGA)?source=Homo sapiens (human)?to=0&format=json
0.261 | 0.011 | count_done; http://172.18.8.71:7700/v1/refseq/query?q=(nt:ACCCCTTGTGAAGCCCAAGATCGTC)?source=Homo sapiens (human)?to=0&format=json
0.273 | 0.012 | count_done; http://172.18.8.71:7700/v1/refseq/query?q=(nt:AACAAAGCACATGCTGCCCAGTGGC)?source=Homo sapiens (human)?to=0&format=json
0.331 | 0.058 | search_done; http://172.18.8.71:7700/v1/refseq/query?q=(nt:TTCCTGGTCCACAACGTCAAGGAGC)%26(nt:TCATCCGGCACCAGTCAGACCGATA)%26(nt:GTAGGCAGCTCATGTGCACGTTTTC)%26(nt:GCCATCGTGGAAAGAGCTGCCCAAC)%26(nt:GCCAGATCTTGATGCCCAACATTGG)%26(nt:CTTACTGTGCCGAGATCGCTCACAA)%26(nt:CTCACAATGTTTCCTCCAAGAACCG)%26(nt:CCCAGTGGCTTCCGGAAGTTCCTGG)%26(nt:CCAATGCCAGGCTGCGCAGTGAAGA)%26(nt:ACCCCTTGTGAAGCCCAAGATCGTC)%26(nt:AACAAAGCACATGCTGCCCAGTGGC)?source=Homo sapiens (human)?to=49?from=0?snippet=full_search?drilldown=source?get=accession,version,gi,length,symbol,synonym,geneid,division,source,definition&format=json
0.333 | 0.002 | cgi_end;

GGRNA ver.2 by @meso_cacase at DBCLS
This page is licensed under a Creative Commons Attribution 4.0 International License (CC BY 4.0).

If you use GGRNA in your work, please cite:
Naito Y, Bono H. (2012)
GGRNA: an ultrafast, transcript-oriented search engine for genes and transcripts.
Nucleic Acids Res., 40, W592-W596. [Full Text]