GGRNA ver.2 Help | Advanced search | Japanese    Previous release (v1)

2021-01-17 00:13:15, GGRNA : RefSeq release 203 (Nov, 2020)

Summary:

Results:

Matches are highlighted with green background. Overlapping matches are dark colored.

Homo sapiens tryptophanyl-tRNA synthetase 1 (WARS1), transcript variant 4, mRNA. (2467 bp)
cttcgttatacatttgactaagaaatcacccagctttaaagctgcttttaacaatgaagattgaacagagttcagcaattttgattaaattaagacttgggggtgaaactttccagtttactgaactccagaccatgcatgtagtccactccagaaatcatgctcgcttcccttggcacaccagtgttctcctgccaaatgaccctagaccctctgtcctgcagagtcagggtggcttttcccctgactgtgtccgatgccaaggagtcctggcctccgcagatgcttcattttgacccttggctgcagtggaagtcagcacagagcagtgccctggctgtgtccctggacgggtggacttagctagggagaaagtcgaggcagcagccctcgaggccctcacagatgtctaggcaggcctcatttcatcacgcagcatgtgcaggcctggaagagcaaagccaaatctcagggaagtccttggttgatgtatctgggtctcctctggagcactctgccctcctgtcacccagtagagtaaataaacttccttggctcctg
position 2018 2034 2126 2154 2254 2279 2297 2314 2329 2372 2387
Synonym: GAMMA-2; HMN9; IFI53; IFP53; WARS
NM_213646.2 - Homo sapiens (human) - NCBI - UCSC - RefEx(expression)
Homo sapiens tryptophanyl-tRNA synthetase 1 (WARS1), transcript variant 3, mRNA. (2470 bp)
cttcgttatacatttgactaagaaatcacccagctttaaagctgcttttaacaatgaagattgaacagagttcagcaattttgattaaattaagacttgggggtgaaactttccagtttactgaactccagaccatgcatgtagtccactccagaaatcatgctcgcttcccttggcacaccagtgttctcctgccaaatgaccctagaccctctgtcctgcagagtcagggtggcttttcccctgactgtgtccgatgccaaggagtcctggcctccgcagatgcttcattttgacccttggctgcagtggaagtcagcacagagcagtgccctggctgtgtccctggacgggtggacttagctagggagaaagtcgaggcagcagccctcgaggccctcacagatgtctaggcaggcctcatttcatcacgcagcatgtgcaggcctggaagagcaaagccaaatctcagggaagtccttggttgatgtatctgggtctcctctggagcactctgccctcctgtcacccagtagagtaaataaacttccttggctcctg
position 2021 2037 2129 2157 2257 2282 2300 2317 2332 2375 2390
Synonym: GAMMA-2; HMN9; IFI53; IFP53; WARS
NM_213645.2 - Homo sapiens (human) - NCBI - UCSC - RefEx(expression)
PREDICTED: Homo sapiens tryptophanyl-tRNA synthetase 1 (WARS1), transcript variant X9, mRNA. (2542 bp)
cttcgttatacatttgactaagaaatcacccagctttaaagctgcttttaacaatgaagattgaacagagttcagcaattttgattaaattaagacttgggggtgaaactttccagtttactgaactccagaccatgcatgtagtccactccagaaatcatgctcgcttcccttggcacaccagtgttctcctgccaaatgaccctagaccctctgtcctgcagagtcagggtggcttttcccctgactgtgtccgatgccaaggagtcctggcctccgcagatgcttcattttgacccttggctgcagtggaagtcagcacagagcagtgccctggctgtgtccctggacgggtggacttagctagggagaaagtcgaggcagcagccctcgaggccctcacagatgtctaggcaggcctcatttcatcacgcagcatgtgcaggcctggaagagcaaagccaaatctcagggaagtccttggttgatgtatctgggtctcctctggagcactctgccctcctgtcacccagtagagtaaataaacttccttggctcctgc
position 2092 2108 2200 2228 2328 2353 2371 2388 2403 2446 2461
Synonym: GAMMA-2; HMN9; IFI53; IFP53; WARS
XM_024449708.1 - Homo sapiens (human) - NCBI - UCSC - RefEx(expression)
PREDICTED: Homo sapiens tryptophanyl-tRNA synthetase 1 (WARS1), transcript variant X6, mRNA. (2606 bp)
cttcgttatacatttgactaagaaatcacccagctttaaagctgcttttaacaatgaagattgaacagagttcagcaattttgattaaattaagacttgggggtgaaactttccagtttactgaactccagaccatgcatgtagtccactccagaaatcatgctcgcttcccttggcacaccagtgttctcctgccaaatgaccctagaccctctgtcctgcagagtcagggtggcttttcccctgactgtgtccgatgccaaggagtcctggcctccgcagatgcttcattttgacccttggctgcagtggaagtcagcacagagcagtgccctggctgtgtccctggacgggtggacttagctagggagaaagtcgaggcagcagccctcgaggccctcacagatgtctaggcaggcctcatttcatcacgcagcatgtgcaggcctggaagagcaaagccaaatctcagggaagtccttggttgatgtatctgggtctcctctggagcactctgccctcctgtcacccagtagagtaaataaacttccttggctcctgc
position 2156 2172 2264 2292 2392 2417 2435 2452 2467 2510 2525
Synonym: GAMMA-2; HMN9; IFI53; IFP53; WARS
XM_005268044.4 - Homo sapiens (human) - NCBI - UCSC - RefEx(expression)
Homo sapiens tryptophanyl-tRNA synthetase 1 (WARS1), transcript variant 1, mRNA. (2639 bp)
cttcgttatacatttgactaagaaatcacccagctttaaagctgcttttaacaatgaagattgaacagagttcagcaattttgattaaattaagacttgggggtgaaactttccagtttactgaactccagaccatgcatgtagtccactccagaaatcatgctcgcttcccttggcacaccagtgttctcctgccaaatgaccctagaccctctgtcctgcagagtcagggtggcttttcccctgactgtgtccgatgccaaggagtcctggcctccgcagatgcttcattttgacccttggctgcagtggaagtcagcacagagcagtgccctggctgtgtccctggacgggtggacttagctagggagaaagtcgaggcagcagccctcgaggccctcacagatgtctaggcaggcctcatttcatcacgcagcatgtgcaggcctggaagagcaaagccaaatctcagggaagtccttggttgatgtatctgggtctcctctggagcactctgccctcctgtcacccagtagagtaaataaacttccttggctcctg
position 2190 2206 2298 2326 2426 2451 2469 2486 2501 2544 2559
Synonym: GAMMA-2; HMN9; IFI53; IFP53; WARS
NM_004184.4 - Homo sapiens (human) - NCBI - UCSC - RefEx(expression)
Homo sapiens tryptophanyl-tRNA synthetase 1 (WARS1), transcript variant 2, mRNA. (2642 bp)
cttcgttatacatttgactaagaaatcacccagctttaaagctgcttttaacaatgaagattgaacagagttcagcaattttgattaaattaagacttgggggtgaaactttccagtttactgaactccagaccatgcatgtagtccactccagaaatcatgctcgcttcccttggcacaccagtgttctcctgccaaatgaccctagaccctctgtcctgcagagtcagggtggcttttcccctgactgtgtccgatgccaaggagtcctggcctccgcagatgcttcattttgacccttggctgcagtggaagtcagcacagagcagtgccctggctgtgtccctggacgggtggacttagctagggagaaagtcgaggcagcagccctcgaggccctcacagatgtctaggcaggcctcatttcatcacgcagcatgtgcaggcctggaagagcaaagccaaatctcagggaagtccttggttgatgtatctgggtctcctctggagcactctgccctcctgtcacccagtagagtaaataaacttccttggctcctg
position 2193 2209 2301 2329 2429 2454 2472 2489 2504 2547 2562
Synonym: GAMMA-2; HMN9; IFI53; IFP53; WARS
NM_173701.2 - Homo sapiens (human) - NCBI - UCSC - RefEx(expression)
PREDICTED: Homo sapiens tryptophanyl-tRNA synthetase 1 (WARS1), transcript variant X8, mRNA. (2698 bp)
cttcgttatacatttgactaagaaatcacccagctttaaagctgcttttaacaatgaagattgaacagagttcagcaattttgattaaattaagacttgggggtgaaactttccagtttactgaactccagaccatgcatgtagtccactccagaaatcatgctcgcttcccttggcacaccagtgttctcctgccaaatgaccctagaccctctgtcctgcagagtcagggtggcttttcccctgactgtgtccgatgccaaggagtcctggcctccgcagatgcttcattttgacccttggctgcagtggaagtcagcacagagcagtgccctggctgtgtccctggacgggtggacttagctagggagaaagtcgaggcagcagccctcgaggccctcacagatgtctaggcaggcctcatttcatcacgcagcatgtgcaggcctggaagagcaaagccaaatctcagggaagtccttggttgatgtatctgggtctcctctggagcactctgccctcctgtcacccagtagagtaaataaacttccttggctcctgc
position 2248 2264 2356 2384 2484 2509 2527 2544 2559 2602 2617
Synonym: GAMMA-2; HMN9; IFI53; IFP53; WARS
XM_011537136.3 - Homo sapiens (human) - NCBI - UCSC - RefEx(expression)
PREDICTED: Homo sapiens tryptophanyl-tRNA synthetase 1 (WARS1), transcript variant X7, mRNA. (2704 bp)
cttcgttatacatttgactaagaaatcacccagctttaaagctgcttttaacaatgaagattgaacagagttcagcaattttgattaaattaagacttgggggtgaaactttccagtttactgaactccagaccatgcatgtagtccactccagaaatcatgctcgcttcccttggcacaccagtgttctcctgccaaatgaccctagaccctctgtcctgcagagtcagggtggcttttcccctgactgtgtccgatgccaaggagtcctggcctccgcagatgcttcattttgacccttggctgcagtggaagtcagcacagagcagtgccctggctgtgtccctggacgggtggacttagctagggagaaagtcgaggcagcagccctcgaggccctcacagatgtctaggcaggcctcatttcatcacgcagcatgtgcaggcctggaagagcaaagccaaatctcagggaagtccttggttgatgtatctgggtctcctctggagcactctgccctcctgtcacccagtagagtaaataaacttccttggctcctgc
position 2254 2270 2362 2390 2490 2515 2533 2550 2565 2608 2623
Synonym: GAMMA-2; HMN9; IFI53; IFP53; WARS
XM_024449707.1 - Homo sapiens (human) - NCBI - UCSC - RefEx(expression)
PREDICTED: Homo sapiens tryptophanyl-tRNA synthetase 1 (WARS1), transcript variant X1, mRNA. (2719 bp)
cttcgttatacatttgactaagaaatcacccagctttaaagctgcttttaacaatgaagattgaacagagttcagcaattttgattaaattaagacttgggggtgaaactttccagtttactgaactccagaccatgcatgtagtccactccagaaatcatgctcgcttcccttggcacaccagtgttctcctgccaaatgaccctagaccctctgtcctgcagagtcagggtggcttttcccctgactgtgtccgatgccaaggagtcctggcctccgcagatgcttcattttgacccttggctgcagtggaagtcagcacagagcagtgccctggctgtgtccctggacgggtggacttagctagggagaaagtcgaggcagcagccctcgaggccctcacagatgtctaggcaggcctcatttcatcacgcagcatgtgcaggcctggaagagcaaagccaaatctcagggaagtccttggttgatgtatctgggtctcctctggagcactctgccctcctgtcacccagtagagtaaataaacttccttggctcctgc
position 2269 2285 2377 2405 2505 2530 2548 2565 2580 2623 2638
Synonym: GAMMA-2; HMN9; IFI53; IFP53; WARS
XM_017021627.2 - Homo sapiens (human) - NCBI - UCSC - RefEx(expression)
PREDICTED: Homo sapiens tryptophanyl-tRNA synthetase 1 (WARS1), transcript variant X5, mRNA. (2845 bp)
cttcgttatacatttgactaagaaatcacccagctttaaagctgcttttaacaatgaagattgaacagagttcagcaattttgattaaattaagacttgggggtgaaactttccagtttactgaactccagaccatgcatgtagtccactccagaaatcatgctcgcttcccttggcacaccagtgttctcctgccaaatgaccctagaccctctgtcctgcagagtcagggtggcttttcccctgactgtgtccgatgccaaggagtcctggcctccgcagatgcttcattttgacccttggctgcagtggaagtcagcacagagcagtgccctggctgtgtccctggacgggtggacttagctagggagaaagtcgaggcagcagccctcgaggccctcacagatgtctaggcaggcctcatttcatcacgcagcatgtgcaggcctggaagagcaaagccaaatctcagggaagtccttggttgatgtatctgggtctcctctggagcactctgccctcctgtcacccagtagagtaaataaacttccttggctcctgc
position 2395 2411 2503 2531 2631 2656 2674 2691 2706 2749 2764
Synonym: GAMMA-2; HMN9; IFI53; IFP53; WARS
XM_006720249.3 - Homo sapiens (human) - NCBI - UCSC - RefEx(expression)
PREDICTED: Homo sapiens tryptophanyl-tRNA synthetase 1 (WARS1), transcript variant X4, mRNA. (2855 bp)
cttcgttatacatttgactaagaaatcacccagctttaaagctgcttttaacaatgaagattgaacagagttcagcaattttgattaaattaagacttgggggtgaaactttccagtttactgaactccagaccatgcatgtagtccactccagaaatcatgctcgcttcccttggcacaccagtgttctcctgccaaatgaccctagaccctctgtcctgcagagtcagggtggcttttcccctgactgtgtccgatgccaaggagtcctggcctccgcagatgcttcattttgacccttggctgcagtggaagtcagcacagagcagtgccctggctgtgtccctggacgggtggacttagctagggagaaagtcgaggcagcagccctcgaggccctcacagatgtctaggcaggcctcatttcatcacgcagcatgtgcaggcctggaagagcaaagccaaatctcagggaagtccttggttgatgtatctgggtctcctctggagcactctgccctcctgtcacccagtagagtaaataaacttccttggctcctgc
position 2405 2421 2513 2541 2641 2666 2684 2701 2716 2759 2774
Synonym: GAMMA-2; HMN9; IFI53; IFP53; WARS
XM_017021629.1 - Homo sapiens (human) - NCBI - UCSC - RefEx(expression)
PREDICTED: Homo sapiens tryptophanyl-tRNA synthetase 1 (WARS1), transcript variant X3, mRNA. (2857 bp)
cttcgttatacatttgactaagaaatcacccagctttaaagctgcttttaacaatgaagattgaacagagttcagcaattttgattaaattaagacttgggggtgaaactttccagtttactgaactccagaccatgcatgtagtccactccagaaatcatgctcgcttcccttggcacaccagtgttctcctgccaaatgaccctagaccctctgtcctgcagagtcagggtggcttttcccctgactgtgtccgatgccaaggagtcctggcctccgcagatgcttcattttgacccttggctgcagtggaagtcagcacagagcagtgccctggctgtgtccctggacgggtggacttagctagggagaaagtcgaggcagcagccctcgaggccctcacagatgtctaggcaggcctcatttcatcacgcagcatgtgcaggcctggaagagcaaagccaaatctcagggaagtccttggttgatgtatctgggtctcctctggagcactctgccctcctgtcacccagtagagtaaataaacttccttggctcctgc
position 2407 2423 2515 2543 2643 2668 2686 2703 2718 2761 2776
Synonym: GAMMA-2; HMN9; IFI53; IFP53; WARS
XM_011537133.2 - Homo sapiens (human) - NCBI - UCSC - RefEx(expression)
PREDICTED: Homo sapiens tryptophanyl-tRNA synthetase 1 (WARS1), transcript variant X2, mRNA. (2982 bp)
cttcgttatacatttgactaagaaatcacccagctttaaagctgcttttaacaatgaagattgaacagagttcagcaattttgattaaattaagacttgggggtgaaactttccagtttactgaactccagaccatgcatgtagtccactccagaaatcatgctcgcttcccttggcacaccagtgttctcctgccaaatgaccctagaccctctgtcctgcagagtcagggtggcttttcccctgactgtgtccgatgccaaggagtcctggcctccgcagatgcttcattttgacccttggctgcagtggaagtcagcacagagcagtgccctggctgtgtccctggacgggtggacttagctagggagaaagtcgaggcagcagccctcgaggccctcacagatgtctaggcaggcctcatttcatcacgcagcatgtgcaggcctggaagagcaaagccaaatctcagggaagtccttggttgatgtatctgggtctcctctggagcactctgccctcctgtcacccagtagagtaaataaacttccttggctcctgc
position 2532 2548 2640 2668 2768 2793 2811 2828 2843 2886 2901
Synonym: GAMMA-2; HMN9; IFI53; IFP53; WARS
XM_024449706.1 - Homo sapiens (human) - NCBI - UCSC - RefEx(expression)

Data Export:

Maximum 10000 results can be retrieved as Tab-delimited text or JSON format.

Debug Info:

Redirect URI : http://ggrna.dbcls.jp/hs/200629_at
lang : en | div : | spe : hs | query_string : 200629_at | format : html | download :

0.000 | 0.000 | search_start;
0.089 | 0.089 | count_done; http://172.18.8.71:7700/v1/refseq/query?q=(nt:TTGGTTGATGTATCTGGGTCTCCTC)?source=Homo sapiens (human)?to=0&format=json
0.100 | 0.011 | count_done; http://172.18.8.71:7700/v1/refseq/query?q=(nt:TGCAGAGTCAGGGTGGCTTTTCCCC)?source=Homo sapiens (human)?to=0&format=json
0.110 | 0.011 | count_done; http://172.18.8.71:7700/v1/refseq/query?q=(nt:TCGAGGCCCTCACAGATGTCTAGGC)?source=Homo sapiens (human)?to=0&format=json
0.122 | 0.012 | count_done; http://172.18.8.71:7700/v1/refseq/query?q=(nt:TCCAGTTTACTGAACTCCAGACCAT)?source=Homo sapiens (human)?to=0&format=json
0.134 | 0.012 | count_done; http://172.18.8.71:7700/v1/refseq/query?q=(nt:GTCTAGGCAGGCCTCATTTCATCAC)?source=Homo sapiens (human)?to=0&format=json
0.145 | 0.011 | count_done; http://172.18.8.71:7700/v1/refseq/query?q=(nt:GGACGGGTGGACTTAGCTAGGGAGA)?source=Homo sapiens (human)?to=0&format=json
0.155 | 0.010 | count_done; http://172.18.8.71:7700/v1/refseq/query?q=(nt:CTGTGTCCGATGCCAAGGAGTCCTG)?source=Homo sapiens (human)?to=0&format=json
0.165 | 0.010 | count_done; http://172.18.8.71:7700/v1/refseq/query?q=(nt:CCAGACCATGCATGTAGTCCACTCC)?source=Homo sapiens (human)?to=0&format=json
0.176 | 0.011 | count_done; http://172.18.8.71:7700/v1/refseq/query?q=(nt:ATTTCATCACGCAGCATGTGCAGGC)?source=Homo sapiens (human)?to=0&format=json
0.187 | 0.010 | count_done; http://172.18.8.71:7700/v1/refseq/query?q=(nt:ATCTCAGGGAAGTCCTTGGTTGATG)?source=Homo sapiens (human)?to=0&format=json
0.197 | 0.011 | count_done; http://172.18.8.71:7700/v1/refseq/query?q=(nt:AAGTCGAGGCAGCAGCCCTCGAGGC)?source=Homo sapiens (human)?to=0&format=json
0.459 | 0.261 | search_done; http://172.18.8.71:7700/v1/refseq/query?q=(nt:TTGGTTGATGTATCTGGGTCTCCTC)%26(nt:TGCAGAGTCAGGGTGGCTTTTCCCC)%26(nt:TCGAGGCCCTCACAGATGTCTAGGC)%26(nt:TCCAGTTTACTGAACTCCAGACCAT)%26(nt:GTCTAGGCAGGCCTCATTTCATCAC)%26(nt:GGACGGGTGGACTTAGCTAGGGAGA)%26(nt:CTGTGTCCGATGCCAAGGAGTCCTG)%26(nt:CCAGACCATGCATGTAGTCCACTCC)%26(nt:ATTTCATCACGCAGCATGTGCAGGC)%26(nt:ATCTCAGGGAAGTCCTTGGTTGATG)%26(nt:AAGTCGAGGCAGCAGCCCTCGAGGC)?source=Homo sapiens (human)?to=49?from=0?snippet=full_search?drilldown=source?get=accession,version,gi,length,symbol,synonym,geneid,division,source,definition&format=json
0.467 | 0.008 | cgi_end;

GGRNA ver.2 by @meso_cacase at DBCLS
This page is licensed under a Creative Commons Attribution 4.0 International License (CC BY 4.0).

If you use GGRNA in your work, please cite:
Naito Y, Bono H. (2012)
GGRNA: an ultrafast, transcript-oriented search engine for genes and transcripts.
Nucleic Acids Res., 40, W592-W596. [Full Text]