GGRNA ver.2 Help | Advanced search | Japanese    Previous release (v1)

2021-01-16 23:42:37, GGRNA : RefSeq release 203 (Nov, 2020)

Summary:

Results:

Matches are highlighted with green background. Overlapping matches are dark colored.

Homo sapiens ribosomal protein L37 (RPL37), transcript variant 2, non-coding RNA. (3083 bp)
phosphorylation and a zinc-finger domain JOURNAL Biochim. Biophys. Acta 1218 (3), 425-428 (1994) PUBMED 7545944 ctcttccggtctttctggtctcggccgcagaagcgagatgacgaagggaacgtcatcgtttggaaagcgtcgcaataagacgcacacgttgtgccgccgctgtggctctaaggcctaccaccttcagaagtcgacctgtggcaaatgtggctaccctgccaagcgcaagagaaagtataactggagtgccaaggctaaaagacgaaataccaccggaactggtcgaatgaggcacctaaaaattgtataccgcagattcaggcatggattccgtgaaggaacaacacctaaacccaagagggcagctgttgcagcatccagttcatcttaagaatgtcaacgattagtcatgcaataaatgttctggttttaaaaaatacatatctggttttggagtttggatcataatacaagagaagcacagggcaaagacactgcataacctcaagaactaagaatggaaggactggccaggcctggtggtgcac...
position 14 40 75 175 215 229 244 255 288 304 332
Synonym: L37
NR_159993.1 - Homo sapiens (human) - NCBI - UCSC - RefEx(expression)
Homo sapiens ribosomal protein L37 (RPL37), transcript variant 1, mRNA. (7573 bp)
phosphorylation and a zinc-finger domain JOURNAL Biochim Biophys Acta 1218 (3), 425-428 (1994) PUBMED 7545944 ctcttccggtctttctggtctcggccgcagaagcgagatgacgaagggaacgtcatcgtttggaaagcgtcgcaataagacgcacacgttgtgccgccgctgtggctctaaggcctaccaccttcagaagtcgacctgtggcaaatgtggctaccctgccaagcgcaagagaaagtataactggagtgccaaggctaaaagacgaaataccaccggaactggtcgaatgaggcacctaaaaattgtataccgcagattcaggcatggattccgtgaaggaacaacacctaaacccaagagggcagctgttgcagcatccagttcatcttaagaatgtcaacgattagtcatgcaataaatgttctggttttaaaaaatacatatctggttttggtaaggtatttttaatcaattaggcttgtagtatcagtgaaatactgtaggtttagggactgggctagcttcatatcagatttacttgttaagtgac...
position 14 40 75 175 215 229 244 255 288 304 332
Synonym: L37
NM_000997.5 - Homo sapiens (human) - NCBI - UCSC - RefEx(expression)

Data Export:

Maximum 10000 results can be retrieved as Tab-delimited text or JSON format.

Debug Info:

Redirect URI : http://ggrna.dbcls.jp/hs/200092_s_at
lang : en | div : | spe : hs | query_string : 200092_s_at | format : html | download :

0.000 | 0.000 | search_start;
0.081 | 0.081 | count_done; http://172.18.8.71:7700/v1/refseq/query?q=(nt:TGTATACCGCAGATTCAGGCATGGA)?source=Homo sapiens (human)?to=0&format=json
0.088 | 0.007 | count_done; http://172.18.8.71:7700/v1/refseq/query?q=(nt:TCTGGTCTCGGCCGCAGAAGCGAGA)?source=Homo sapiens (human)?to=0&format=json
0.094 | 0.006 | count_done; http://172.18.8.71:7700/v1/refseq/query?q=(nt:GTATAACTGGAGTGCCAAGGCTAAA)?source=Homo sapiens (human)?to=0&format=json
0.102 | 0.008 | count_done; http://172.18.8.71:7700/v1/refseq/query?q=(nt:GGAACTGGTCGAATGAGGCACCTAA)?source=Homo sapiens (human)?to=0&format=json
0.109 | 0.007 | count_done; http://172.18.8.71:7700/v1/refseq/query?q=(nt:GATTCAGGCATGGATTCCGTGAAGG)?source=Homo sapiens (human)?to=0&format=json
0.116 | 0.007 | count_done; http://172.18.8.71:7700/v1/refseq/query?q=(nt:GAGGCACCTAAAAATTGTATACCGC)?source=Homo sapiens (human)?to=0&format=json
0.124 | 0.008 | count_done; http://172.18.8.71:7700/v1/refseq/query?q=(nt:GACGAAGGGAACGTCATCGTTTGGA)?source=Homo sapiens (human)?to=0&format=json
0.131 | 0.008 | count_done; http://172.18.8.71:7700/v1/refseq/query?q=(nt:GAATGTCAACGATTAGTCATGCAAT)?source=Homo sapiens (human)?to=0&format=json
0.139 | 0.007 | count_done; http://172.18.8.71:7700/v1/refseq/query?q=(nt:CTAAACCCAAGAGGGCAGCTGTTGC)?source=Homo sapiens (human)?to=0&format=json
0.289 | 0.150 | count_done; http://172.18.8.71:7700/v1/refseq/query?q=(nt:ATAAGACGCACACGTTGTGCCGCCG)?source=Homo sapiens (human)?to=0&format=json
0.304 | 0.015 | count_done; http://172.18.8.71:7700/v1/refseq/query?q=(nt:AGCTGTTGCAGCATCCAGTTCATCT)?source=Homo sapiens (human)?to=0&format=json
0.369 | 0.065 | search_done; http://172.18.8.71:7700/v1/refseq/query?q=(nt:TGTATACCGCAGATTCAGGCATGGA)%26(nt:TCTGGTCTCGGCCGCAGAAGCGAGA)%26(nt:GTATAACTGGAGTGCCAAGGCTAAA)%26(nt:GGAACTGGTCGAATGAGGCACCTAA)%26(nt:GATTCAGGCATGGATTCCGTGAAGG)%26(nt:GAGGCACCTAAAAATTGTATACCGC)%26(nt:GACGAAGGGAACGTCATCGTTTGGA)%26(nt:GAATGTCAACGATTAGTCATGCAAT)%26(nt:CTAAACCCAAGAGGGCAGCTGTTGC)%26(nt:ATAAGACGCACACGTTGTGCCGCCG)%26(nt:AGCTGTTGCAGCATCCAGTTCATCT)?source=Homo sapiens (human)?to=49?from=0?snippet=full_search?drilldown=source?get=accession,version,gi,length,symbol,synonym,geneid,division,source,definition&format=json
0.370 | 0.001 | cgi_end;

GGRNA ver.2 by @meso_cacase at DBCLS
This page is licensed under a Creative Commons Attribution 4.0 International License (CC BY 4.0).

If you use GGRNA in your work, please cite:
Naito Y, Bono H. (2012)
GGRNA: an ultrafast, transcript-oriented search engine for genes and transcripts.
Nucleic Acids Res., 40, W592-W596. [Full Text]