GGRNA ver.2 Help | Advanced search | Japanese    Previous release (v1)

2021-01-24 04:48:42, GGRNA : RefSeq release 203 (Nov, 2020)

Summary:

Results:

Matches are highlighted with green background. Overlapping matches are dark colored.

Homo sapiens ribosomal protein L9 (RPL9), transcript variant 1, mRNA. (724 bp)
gggacgcacagttatcgtgaagggccccagaggaaccctgcggagggacttcaatcacatcaatgtagaactcagccttcttggaaagaaaaaaaagaggctccgggttgacaaatggtggggtaacagaaaggaactggctaccgttcggactatttgtagtcatgtacagaacatgatcaagggtgttacactgggcttccgttacaagatgaggtctgtgtatgctcacttccccatcaacgttgttatccaggagaatgggtctcttgttgaaatccgaaatttcttgggtgaaaaatatatccgcagggttcggatgagaccaggtgttgcttgttcagtatctcaagcccagaaagatgaattaatccttgaaggaaatgacattgagcttgtttcaaattcagcggctttgattcagcaagccacaacagttaaaaacaaggatatcaggaaatttttggatggtatctatgtctctgaaaaaggaactgttcagcaggctgatgaataagatctaagagttacctggctacagaaagaagatgccagatgacacttaagacctacttgtgatatttaaatgatgcaataaaa...
position 121 135 150 192 231 284 329 432 511 613 646
Synonym: L9; NPC-A-16
NM_000661.5 - Homo sapiens (human) - NCBI - UCSC - RefEx(expression)
Homo sapiens ribosomal protein L9 (RPL9), transcript variant 2, mRNA. (882 bp)
gggacgcacagttatcgtgaagggccccagaggaaccctgcggagggacttcaatcacatcaatgtagaactcagccttcttggaaagaaaaaaaagaggctccgggttgacaaatggtggggtaacagaaaggaactggctaccgttcggactatttgtagtcatgtacagaacatgatcaagggtgttacactgggcttccgttacaagatgaggtctgtgtatgctcacttccccatcaacgttgttatccaggagaatgggtctcttgttgaaatccgaaatttcttgggtgaaaaatatatccgcagggttcggatgagaccaggtgttgcttgttcagtatctcaagcccagaaagatgaattaatccttgaaggaaatgacattgagcttgtttcaaattcagcggctttgattcagcaagccacaacagttaaaaacaaggatatcaggaaatttttggatggtatctatgtctctgaaaaaggaactgttcagcaggctgatgaataagatctaagagttacctggctacagaaagaagatgccagatgacacttaagacctacttgtgatatttaaatgatgcaataaaa...
position 279 293 308 350 389 442 487 590 669 771 804
Synonym: L9; NPC-A-16
NM_001024921.4 - Homo sapiens (human) - NCBI - UCSC - RefEx(expression)

Data Export:

Maximum 10000 results can be retrieved as Tab-delimited text or JSON format.

Debug Info:

Redirect URI : http://ggrna.dbcls.jp/hs/200032_s_at
lang : en | div : | spe : hs | query_string : 200032_s_at | format : html | download :

0.000 | 0.000 | search_start;
0.089 | 0.089 | count_done; http://172.18.8.71:7700/v1/refseq/query?q=(nt:TTGTTCAGTATCTCAAGCCCAGAAA)?source=Homo sapiens (human)?to=0&format=json
0.099 | 0.009 | count_done; http://172.18.8.71:7700/v1/refseq/query?q=(nt:TTGATTCAGCAAGCCACAACAGTTA)?source=Homo sapiens (human)?to=0&format=json
0.110 | 0.011 | count_done; http://172.18.8.71:7700/v1/refseq/query?q=(nt:TTACACTGGGCTTCCGTTACAAGAT)?source=Homo sapiens (human)?to=0&format=json
0.119 | 0.009 | count_done; http://172.18.8.71:7700/v1/refseq/query?q=(nt:TCCCCATCAACGTTGTTATCCAGGA)?source=Homo sapiens (human)?to=0&format=json
0.129 | 0.010 | count_done; http://172.18.8.71:7700/v1/refseq/query?q=(nt:TCACATCAATGTAGAACTCAGCCTT)?source=Homo sapiens (human)?to=0&format=json
0.138 | 0.009 | count_done; http://172.18.8.71:7700/v1/refseq/query?q=(nt:GCGGAGGGACTTCAATCACATCAAT)?source=Homo sapiens (human)?to=0&format=json
0.451 | 0.313 | count_done; http://172.18.8.71:7700/v1/refseq/query?q=(nt:GCCAGATGACACTTAAGACCTACTT)?source=Homo sapiens (human)?to=0&format=json
0.463 | 0.012 | count_done; http://172.18.8.71:7700/v1/refseq/query?q=(nt:GATCTAAGAGTTACCTGGCTACAGA)?source=Homo sapiens (human)?to=0&format=json
0.474 | 0.011 | count_done; http://172.18.8.71:7700/v1/refseq/query?q=(nt:GAGGCTCCGGGTTGACAAATGGTGG)?source=Homo sapiens (human)?to=0&format=json
0.485 | 0.011 | count_done; http://172.18.8.71:7700/v1/refseq/query?q=(nt:CCCAGAGGAACCCTGCGGAGGGACT)?source=Homo sapiens (human)?to=0&format=json
0.494 | 0.009 | count_done; http://172.18.8.71:7700/v1/refseq/query?q=(nt:ACTGGCTACCGTTCGGACTATTTGT)?source=Homo sapiens (human)?to=0&format=json
0.527 | 0.033 | search_done; http://172.18.8.71:7700/v1/refseq/query?q=(nt:TTGTTCAGTATCTCAAGCCCAGAAA)%26(nt:TTGATTCAGCAAGCCACAACAGTTA)%26(nt:TTACACTGGGCTTCCGTTACAAGAT)%26(nt:TCCCCATCAACGTTGTTATCCAGGA)%26(nt:TCACATCAATGTAGAACTCAGCCTT)%26(nt:GCGGAGGGACTTCAATCACATCAAT)%26(nt:GCCAGATGACACTTAAGACCTACTT)%26(nt:GATCTAAGAGTTACCTGGCTACAGA)%26(nt:GAGGCTCCGGGTTGACAAATGGTGG)%26(nt:CCCAGAGGAACCCTGCGGAGGGACT)%26(nt:ACTGGCTACCGTTCGGACTATTTGT)?source=Homo sapiens (human)?to=49?from=0?snippet=full_search?drilldown=source?get=accession,version,gi,length,symbol,synonym,geneid,division,source,definition&format=json
0.528 | 0.001 | cgi_end;

GGRNA ver.2 by @meso_cacase at DBCLS
This page is licensed under a Creative Commons Attribution 4.0 International License (CC BY 4.0).

If you use GGRNA in your work, please cite:
Naito Y, Bono H. (2012)
GGRNA: an ultrafast, transcript-oriented search engine for genes and transcripts.
Nucleic Acids Res., 40, W592-W596. [Full Text]