GGRNA ver.2 Help | Advanced search | Japanese    Previous release (v1)

2021-01-17 00:03:36, GGRNA : RefSeq release 203 (Nov, 2020)

Summary:

Results:

Matches are highlighted with green background. Overlapping matches are dark colored.

Homo sapiens ribosomal protein L27 (RPL27), transcript variant 1, mRNA. (505 bp)
gtgtccttctttcctttttgctggtagggccgggtggttgctgccgaaatgggcaagttcatgaaacctgggaaggtggtgcttgtcctggctggacgctactccggacgcaaagctgtcatcgtgaagaacattgatgatggcacctcagatcgcccctacagccatgctctggtggctggaattgaccgctacccccgcaaagtgacagctgccatgggcaagaagaagatcgccaagagatcaaagataaaatcttttgtgaaagtgtataactacaatcacctaatgcccacaaggtactctgtggatatccccttggacaaaactgtcgtcaataaggatgtcttcagagatcctgctcttaaacgcaaggcccgacgggaggccaaggtcaagtttgaagagagatacaagacaggcaagaacaagtggttcttccagaaactgcggttttagatgctttgttttgatcattaaaaattataaagaaaaaaa
position 141 179 302 310 317 334 349 357 420 437 451
Synonym: DBA16; L27
NM_000988.5 - Homo sapiens (human) - NCBI - UCSC - RefEx(expression)
Homo sapiens ribosomal protein L27 (RPL27), transcript variant 2, mRNA. (595 bp)
tgaagggcgggacaggaagtgaggtcactcctcaccggggtgaaagaaatgggcaagttcatgaaacctgggaaggtggtgcttgtcctggctggacgctactccggacgcaaagctgtcatcgtgaagaacattgatgatggcacctcagatcgcccctacagccatgctctggtggctggaattgaccgctacccccgcaaagtgacagctgccatgggcaagaagaagatcgccaagagatcaaagataaaatcttttgtgaaagtgtataactacaatcacctaatgcccacaaggtactctgtggatatccccttggacaaaactgtcgtcaataaggatgtcttcagagatcctgctcttaaacgcaaggcccgacgggaggccaaggtcaagtttgaagagagatacaagacaggcaagaacaagtggttcttccagaaactgcggttttagatgctttgttttgatcattaaaaattataaagaaaaaaa
position 231 269 392 400 407 424 439 447 510 527 541
Synonym: DBA16; L27
NM_001349921.2 - Homo sapiens (human) - NCBI - UCSC - RefEx(expression)
Homo sapiens ribosomal protein L27 (RPL27), transcript variant 3, mRNA. (782 bp)
tggctttacggatttttaagtggccctttctccttgctctctgcagaaatgggcaagttcatgaaacctgggaaggtggtgcttgtcctggctggacgctactccggacgcaaagctgtcatcgtgaagaacattgatgatggcacctcagatcgcccctacagccatgctctggtggctggaattgaccgctacccccgcaaagtgacagctgccatgggcaagaagaagatcgccaagagatcaaagataaaatcttttgtgaaagtgtataactacaatcacctaatgcccacaaggtactctgtggatatccccttggacaaaactgtcgtcaataaggatgtcttcagagatcctgctcttaaacgcaaggcccgacgggaggccaaggtcaagtttgaagagagatacaagacaggcaagaacaagtggttcttccagaaactgcggttttagatgctttgttttgatcattaaaaattataaagaaaaaaa
position 418 456 579 587 594 611 626 634 697 714 728
Synonym: DBA16; L27
NM_001349922.2 - Homo sapiens (human) - NCBI - UCSC - RefEx(expression)

Data Export:

Maximum 10000 results can be retrieved as Tab-delimited text or JSON format.

Debug Info:

Redirect URI : http://ggrna.dbcls.jp/hs/200025_s_at
lang : en | div : | spe : hs | query_string : 200025_s_at | format : html | download :

0.000 | 0.000 | search_start;
0.089 | 0.089 | count_done; http://172.18.8.71:7700/v1/refseq/query?q=(nt:TTGATGATGGCACCTCAGATCGCCC)?source=Homo sapiens (human)?to=0&format=json
0.101 | 0.012 | count_done; http://172.18.8.71:7700/v1/refseq/query?q=(nt:TCAGAGATCCTGCTCTTAAACGCAA)?source=Homo sapiens (human)?to=0&format=json
0.114 | 0.013 | count_done; http://172.18.8.71:7700/v1/refseq/query?q=(nt:GGATGTCTTCAGAGATCCTGCTCTT)?source=Homo sapiens (human)?to=0&format=json
0.125 | 0.011 | count_done; http://172.18.8.71:7700/v1/refseq/query?q=(nt:GATATCCCCTTGGACAAAACTGTCG)?source=Homo sapiens (human)?to=0&format=json
0.135 | 0.010 | count_done; http://172.18.8.71:7700/v1/refseq/query?q=(nt:GAAACTGCGGTTTTAGATGCTTTGT)?source=Homo sapiens (human)?to=0&format=json
0.145 | 0.010 | count_done; http://172.18.8.71:7700/v1/refseq/query?q=(nt:CTGGTGGCTGGAATTGACCGCTACC)?source=Homo sapiens (human)?to=0&format=json
0.155 | 0.009 | count_done; http://172.18.8.71:7700/v1/refseq/query?q=(nt:CTCTGTGGATATCCCCTTGGACAAA)?source=Homo sapiens (human)?to=0&format=json
0.165 | 0.010 | count_done; http://172.18.8.71:7700/v1/refseq/query?q=(nt:ACAAGGTACTCTGTGGATATCCCCT)?source=Homo sapiens (human)?to=0&format=json
0.175 | 0.010 | count_done; http://172.18.8.71:7700/v1/refseq/query?q=(nt:ACAAGACAGGCAAGAACAAGTGGTT)?source=Homo sapiens (human)?to=0&format=json
0.186 | 0.011 | count_done; http://172.18.8.71:7700/v1/refseq/query?q=(nt:AAGTGGTTCTTCCAGAAACTGCGGT)?source=Homo sapiens (human)?to=0&format=json
0.195 | 0.009 | count_done; http://172.18.8.71:7700/v1/refseq/query?q=(nt:AACTGTCGTCAATAAGGATGTCTTC)?source=Homo sapiens (human)?to=0&format=json
0.239 | 0.044 | search_done; http://172.18.8.71:7700/v1/refseq/query?q=(nt:TTGATGATGGCACCTCAGATCGCCC)%26(nt:TCAGAGATCCTGCTCTTAAACGCAA)%26(nt:GGATGTCTTCAGAGATCCTGCTCTT)%26(nt:GATATCCCCTTGGACAAAACTGTCG)%26(nt:GAAACTGCGGTTTTAGATGCTTTGT)%26(nt:CTGGTGGCTGGAATTGACCGCTACC)%26(nt:CTCTGTGGATATCCCCTTGGACAAA)%26(nt:ACAAGGTACTCTGTGGATATCCCCT)%26(nt:ACAAGACAGGCAAGAACAAGTGGTT)%26(nt:AAGTGGTTCTTCCAGAAACTGCGGT)%26(nt:AACTGTCGTCAATAAGGATGTCTTC)?source=Homo sapiens (human)?to=49?from=0?snippet=full_search?drilldown=source?get=accession,version,gi,length,symbol,synonym,geneid,division,source,definition&format=json
0.241 | 0.002 | cgi_end;

GGRNA ver.2 by @meso_cacase at DBCLS
This page is licensed under a Creative Commons Attribution 4.0 International License (CC BY 4.0).

If you use GGRNA in your work, please cite:
Naito Y, Bono H. (2012)
GGRNA: an ultrafast, transcript-oriented search engine for genes and transcripts.
Nucleic Acids Res., 40, W592-W596. [Full Text]