GGRNA ver.2 Help | Advanced search | Japanese    Previous release (v1)

2021-01-16 23:14:46, GGRNA : RefSeq release 203 (Nov, 2020)

Summary:

Results:

Matches are highlighted with green background. Overlapping matches are dark colored.

Homo sapiens ribosomal protein L24 (RPL24), mRNA. (560 bp)
of Saccharomyces cerevisiae ribosomal protein L30 JOURNAL Gene 123 (2), 283-285 (1993) PUBMED 8428672 ctttcttttcgccatcttttgtctttccgtggagctgtcgccatgaaggtcgagctgtgcagttttagcgggtacaagatctaccccggacacgggaggcgctacgccaggaccgacgggaaggttttccagtttcttaatgcgaaatgcgagtcggctttcctttccaagaggaatcctcggcagataaactggactgtcctctacagaaggaagcacaaaaagggacagtcggaagaaattcaaaagaaaagaacccgccgagcagtcaaattccagagggccattactggtgcatctcttgctgatataatggccaagaggaatcagaaacctgaagttagaaaggctcaacgagaacaagctatcagggctgctaaggaagcaaaaaaggctaagcaagcatctaaaaagactgcaatggctgctgctaaggcacctacaaaggcagcacctaagcaaaagattgtgaagcctgtgaaagtttcagctccccga...
position 14 31 48 68 143 171 186 251 267 286 354
Synonym: HEL-S-310; L24
NM_000986.4 - Homo sapiens (human) - NCBI - UCSC - RefEx(expression)

Data Export:

Maximum 10000 results can be retrieved as Tab-delimited text or JSON format.

Debug Info:

Redirect URI : http://ggrna.dbcls.jp/hs/200013_at
lang : en | div : | spe : hs | query_string : 200013_at | format : html | download :

0.000 | 0.000 | search_start;
0.086 | 0.086 | count_done; http://172.18.8.71:7700/v1/refseq/query?q=(nt:GGTCGAGCTGTGCAGTTTTAGCGGG)?source=Homo sapiens (human)?to=0&format=json
0.096 | 0.010 | count_done; http://172.18.8.71:7700/v1/refseq/query?q=(nt:GGAGCTGTCGCCATGAAGGTCGAGC)?source=Homo sapiens (human)?to=0&format=json
0.107 | 0.011 | count_done; http://172.18.8.71:7700/v1/refseq/query?q=(nt:GCGGGTACAAGATCTACCCCGGACA)?source=Homo sapiens (human)?to=0&format=json
0.118 | 0.011 | count_done; http://172.18.8.71:7700/v1/refseq/query?q=(nt:GATAAACTGGACTGTCCTCTACAGA)?source=Homo sapiens (human)?to=0&format=json
0.128 | 0.010 | count_done; http://172.18.8.71:7700/v1/refseq/query?q=(nt:GAGGAATCCTCGGCAGATAAACTGG)?source=Homo sapiens (human)?to=0&format=json
0.138 | 0.009 | count_done; http://172.18.8.71:7700/v1/refseq/query?q=(nt:CGAAATGCGAGTCGGCTTTCCTTTC)?source=Homo sapiens (human)?to=0&format=json
0.147 | 0.010 | count_done; http://172.18.8.71:7700/v1/refseq/query?q=(nt:ATTACTGGTGCATCTCTTGCTGATA)?source=Homo sapiens (human)?to=0&format=json
0.157 | 0.010 | count_done; http://172.18.8.71:7700/v1/refseq/query?q=(nt:ATCTTTTGTCTTTCCGTGGAGCTGT)?source=Homo sapiens (human)?to=0&format=json
0.169 | 0.012 | count_done; http://172.18.8.71:7700/v1/refseq/query?q=(nt:AGTCAAATTCCAGAGGGCCATTACT)?source=Homo sapiens (human)?to=0&format=json
0.179 | 0.010 | count_done; http://172.18.8.71:7700/v1/refseq/query?q=(nt:ACGAGAACAAGCTATCAGGGCTGCT)?source=Homo sapiens (human)?to=0&format=json
0.190 | 0.011 | count_done; http://172.18.8.71:7700/v1/refseq/query?q=(nt:AAAGAACCCGCCGAGCAGTCAAATT)?source=Homo sapiens (human)?to=0&format=json
0.212 | 0.022 | search_done; http://172.18.8.71:7700/v1/refseq/query?q=(nt:GGTCGAGCTGTGCAGTTTTAGCGGG)%26(nt:GGAGCTGTCGCCATGAAGGTCGAGC)%26(nt:GCGGGTACAAGATCTACCCCGGACA)%26(nt:GATAAACTGGACTGTCCTCTACAGA)%26(nt:GAGGAATCCTCGGCAGATAAACTGG)%26(nt:CGAAATGCGAGTCGGCTTTCCTTTC)%26(nt:ATTACTGGTGCATCTCTTGCTGATA)%26(nt:ATCTTTTGTCTTTCCGTGGAGCTGT)%26(nt:AGTCAAATTCCAGAGGGCCATTACT)%26(nt:ACGAGAACAAGCTATCAGGGCTGCT)%26(nt:AAAGAACCCGCCGAGCAGTCAAATT)?source=Homo sapiens (human)?to=49?from=0?snippet=full_search?drilldown=source?get=accession,version,gi,length,symbol,synonym,geneid,division,source,definition&format=json
0.213 | 0.001 | cgi_end;

GGRNA ver.2 by @meso_cacase at DBCLS
This page is licensed under a Creative Commons Attribution 4.0 International License (CC BY 4.0).

If you use GGRNA in your work, please cite:
Naito Y, Bono H. (2012)
GGRNA: an ultrafast, transcript-oriented search engine for genes and transcripts.
Nucleic Acids Res., 40, W592-W596. [Full Text]