2024-05-03 03:27:30, GGRNA.v2 : RefSeq release 222 (Jan, 2024)
LOCUS XM_046927274 1990 bp mRNA linear VRT 01-MAR-2022 DEFINITION PREDICTED: Gallus gallus eukaryotic translation initiation factor 2 alpha kinase 1 (EIF2AK1), transcript variant X3, mRNA. ACCESSION XM_046927274 VERSION XM_046927274.1 DBLINK BioProject: PRJNA698614 KEYWORDS RefSeq. SOURCE Gallus gallus (chicken) ORGANISM Gallus gallus Eukaryota; Metazoa; Chordata; Craniata; Vertebrata; Euteleostomi; Archelosauria; Archosauria; Dinosauria; Saurischia; Theropoda; Coelurosauria; Aves; Neognathae; Galloanserae; Galliformes; Phasianidae; Phasianinae; Gallus. COMMENT MODEL REFSEQ: This record is predicted by automated computational analysis. This record is derived from a genomic sequence (NC_052586.1) annotated using gene prediction method: Gnomon, supported by mRNA and EST evidence. Also see: Documentation of NCBI's Annotation Process ##Genome-Annotation-Data-START## Annotation Provider :: NCBI Annotation Status :: Full annotation Annotation Name :: Gallus gallus Annotation Release 106 Annotation Version :: 106 Annotation Pipeline :: NCBI eukaryotic genome annotation pipeline Annotation Software Version :: 9.0 Annotation Method :: Best-placed RefSeq; Gnomon Features Annotated :: Gene; mRNA; CDS; ncRNA ##Genome-Annotation-Data-END## FEATURES Location/Qualifiers source 1..1990 /organism="Gallus gallus" /mol_type="mRNA" /isolate="bGalGal1" /db_xref="taxon:9031" /chromosome="14" /sex="female" /tissue_type="blood" /country="USA: Fayetteville" /lat_lon="36.0822 N 94.1719 W" /collection_date="20-May-2019" /collected_by="Nick Anthony" gene 1..1990 /gene="EIF2AK1" /note="eukaryotic translation initiation factor 2 alpha kinase 1; Derived by automated computational analysis using gene prediction method: Gnomon. Supporting evidence includes similarity to: 1 mRNA, 8 ESTs, 30 long SRA reads, and 100% coverage of the annotated genomic feature by RNAseq alignments, including 48 samples with support for all annotated introns" /db_xref="CGNC:2470" /db_xref="GeneID:395360" misc_feature 1 /gene="EIF2AK1" /experiment="COORDINATES: cap analysis [ECO:0007248]" /note="transcription start site" CDS 248..1915 /gene="EIF2AK1" /codon_start=1 /product="eukaryotic translation initiation factor 2-alpha kinase 1 isoform X3" /protein_id="XP_046783230.1" /db_xref="GeneID:395360" /db_xref="CGNC:2470" /translation="
MWDVSPEICSFVLRQAFTRTGLLSPFAFCDEFSTVRLQHNRAITELMKAANRQVLNGELDNGDSRAIGEKEVLLEAQTSRYLNEFDEIARLGKGGYGQVYKVRNKLDGQFYAIKKINIKKATRRDCMKVLREVKVLAGLQHPNIVGYHTAWMEHVQTACPKDKTVLKLQSLPLEQESGDDHCHIQSVESGSSIIFADLTSQEEKSGDSTRLRNPDGESVQNMDVRNDFTNSNSKEICMKPNRCELPIELQEDSDSSVDCRSTDLKHDSSYDPPCSLDLDASAGSKSCTEECSGNDVALCGEFEVEYRLMLYIQMQLCELSLWDWIAARNKRCNERTEDAAGLYHLVDVSWTMKIFEELLEGVCYIHSMGVMHRDIKPRNIFLHGSDHQVKIGDFGLACKDLLWDDADQWFHTERINGLTHTSGVGTCLYASPEQLQGSDYDFKSDMYSLGVILLELFQPFGTEMERAEVITNLRNGHIPHNFCKKWPVQAKYVKLLTSQVSTERPTAAQLRESELFHTTEHQKVREQEEEIEKLKEKLRLLSTGQDEHMKQGSPV"
misc_feature 479..1789 /gene="EIF2AK1" /note="Catalytic domain of the Serine/Threonine kinase, eukaryotic translation Initiation Factor 2-Alpha Kinase 2 or Heme-Regulated Inhibitor kinase; Region: STKc_EIF2AK1_HRI; cd14049" /db_xref="CDD:270951" misc_feature order(479..487,494..499,635..640,647..652,656..661, 683..709,713..715,1175..1177,1337..1339,1346..1354) /gene="EIF2AK1" /note="dimer interface [polypeptide binding]; other site" /db_xref="CDD:270951" misc_feature 497..>1066 /gene="EIF2AK1" /note="Protein Kinases, catalytic domain; Region: PKc_like; cl21453" /db_xref="CDD:451246" misc_feature order(518..523,536..538,542..544,581..583,587..589, 1187..1198,1205..1207,1379..1384,1388..1390,1424..1426, 1523..1531,1622..1624,1628..1651) /gene="EIF2AK1" /note="active site" /db_xref="CDD:270951" misc_feature order(518..523,536..538,542..544,581..583,587..589, 680..682,1187..1198,1205..1207,1367..1369,1373..1375, 1379..1384,1388..1390,1424..1426) /gene="EIF2AK1" /note="ATP binding site [chemical binding]; other site" /db_xref="CDD:270951" misc_feature order(518..529,536..538,542..544,581..583,587..589, 680..682,803..805,806..808,914..916,923..925,929..931, 1031..1036) /gene="EIF2AK1" /note="ATP binding site [chemical binding]; other site" /db_xref="CDD:270870" misc_feature order(1421..1450,1496..1531) /gene="EIF2AK1" /note="activation loop (A-loop); other site" /db_xref="CDD:270951" misc_feature order(1523..1531,1622..1624,1628..1651) /gene="EIF2AK1" /note="eIF2alpha (substrate) binding site [polypeptide binding]; other site" /db_xref="CDD:270951" polyA_site 1990 /gene="EIF2AK1" /experiment="COORDINATES: polyA evidence [ECO:0006239]" ORIGIN
acaggaaggaaagcaaaagcaaggtagtttgcttgagggagcttaggctctgtggtgatataaaatgggatctaaaaacacagataaaagaggggcttgttagaaatacttatcaggaaatagctgtggtgtggtcttctctgcgcctgccaagattatgttctgtgaaagtcagagtaaataatcttggaagtcccttattttccaacagagtcctttgacgtaattctagagcttgcgttcttagatgtgggatgtttctcctgaaatctgttcctttgtacttcgacaggctttcacgagaacaggtttgctctccccttttgccttctgtgatgaatttagtactgtaagactgcagcataatagagccattactgagctaatgaaagcagctaaccgacaagtgcttaatggggagcttgataatggagattctcgtgcaattggggaaaaagaagttctcttggaagcacagacatcacgatacttgaatgaatttgatgagattgcaagattaggaaaaggaggatatggccaagtatacaaggtcagaaacaagttagatggtcagttctatgctattaaaaaaatcaatattaagaaggctacaagaagagattgcatgaaggtgctacgagaggttaaagtgctggctggactgcagcatcctaatattgtgggctatcacactgcttggatggaacacgttcaaacagcttgcccaaaggataagacagtattgaagttgcagtcattacccttggaacaggagagtggagatgatcactgtcacattcagagtgtggaaagtggtagttcaattatttttgctgaccttacttcacaagaagaaaagtctggtgacagtacacgtcttagaaatccagatggtgaatcggtgcagaatatggatgtaaggaatgatttcactaacagcaatagtaaggaaatatgtatgaaaccaaatagatgtgaattacccatagaactacaagaagactctgacagtagtgttgactgtagatcaactgatttaaaacatgattcatcgtacgacccaccctgtagtctggatctagatgctagtgctggaagcaagtcctgcaccgaagagtgctctgggaatgatgtagctctctgtggagagtttgaggtggagtatcgtttgatgctttatatacagatgcaactgtgtgaactgtccctgtgggactggattgctgcccgtaacaaaagatgcaatgagagaacagaggatgctgctggtctgtaccaccttgtggatgtcagctggacaatgaaaatttttgaagagttattagaaggagtgtgctatatccacagcatgggagtgatgcatcgagacattaaacccagaaatatctttttgcatggatcagatcatcaagttaaaataggagattttggattagcctgcaaagacctcctttgggatgatgcagaccagtggtttcacacagaaaggataaatggactgacacatacctcaggtgtggggacttgcctgtatgcttcaccagaacagctgcaggggtctgactacgacttcaagtcagacatgtacagcttgggtgttatcctgctagaactcttccagccatttggaacagaaatggaaagagcagaagttataacaaatttaaggaatggccacattcctcataacttctgcaagaaatggcctgttcaagccaagtatgtaaaacttctcaccagtcaggtatccacagaaagaccaactgctgctcaacttcgtgaaagtgagctgtttcataccacagaacatcaaaaggtgagagagcaagaagaagaaatagaaaaactgaaagagaaactaagactgctttctactggacaagatgaacatatgaaacaaggttctccggtttaagtacaggaagaacacaactattgtatattaagttatagaaaacagggtttttttacataaaaatagttcagtgca
//
by
@meso_cacase at
DBCLS
This page is licensed under a
Creative Commons Attribution 4.0 International License (CC BY 4.0).
If you use GGRNA in your work, please cite:
Naito Y, Bono H. (2012)
GGRNA: an ultrafast, transcript-oriented search engine for genes and transcripts.
Nucleic Acids Res., 40, W592-W596.
[Full Text]