2024-05-20 10:23:23, GGRNA.v2 : RefSeq release 222 (Jan, 2024)
LOCUS XM_046906018 1095 bp mRNA linear VRT 01-MAR-2022 DEFINITION PREDICTED: Gallus gallus apical junction molecule-like (LOC121112685), transcript variant X1, mRNA. ACCESSION XM_046906018 VERSION XM_046906018.1 DBLINK BioProject: PRJNA698609 KEYWORDS RefSeq; includes ab initio. SOURCE Gallus gallus (chicken) ORGANISM Gallus gallus Eukaryota; Metazoa; Chordata; Craniata; Vertebrata; Euteleostomi; Archelosauria; Archosauria; Dinosauria; Saurischia; Theropoda; Coelurosauria; Aves; Neognathae; Galloanserae; Galliformes; Phasianidae; Phasianinae; Gallus. COMMENT MODEL REFSEQ: This record is predicted by automated computational analysis. This record is derived from a genomic sequence (NW_024095950.1) annotated using gene prediction method: Gnomon, supported by EST evidence. Also see: Documentation of NCBI's Annotation Process ##Genome-Annotation-Data-START## Annotation Provider :: NCBI Annotation Status :: Full annotation Annotation Name :: Gallus gallus Annotation Release 106 Annotation Version :: 106 Annotation Pipeline :: NCBI eukaryotic genome annotation pipeline Annotation Software Version :: 9.0 Annotation Method :: Best-placed RefSeq; Gnomon Features Annotated :: Gene; mRNA; CDS; ncRNA ##Genome-Annotation-Data-END## ##RefSeq-Attributes-START## ab initio :: 17% of CDS bases ##RefSeq-Attributes-END## FEATURES Location/Qualifiers source 1..1095 /organism="Gallus gallus" /mol_type="mRNA" /isolate="bGalGal1" /db_xref="taxon:9031" /chromosome="32" /map="unlocalized" /sex="female" /tissue_type="blood" /country="USA: Fayetteville" /lat_lon="36.0822 N 94.1719 W" /collection_date="20-May-2019" /collected_by="Nick Anthony" gene 1..1095 /gene="LOC121112685" /note="Derived by automated computational analysis using gene prediction method: Gnomon. Supporting evidence includes similarity to: 3 ESTs, and 92% coverage of the annotated genomic feature by RNAseq alignments" /db_xref="CGNC:92539" /db_xref="GeneID:121112685" CDS 628..1095 /gene="LOC121112685" /codon_start=1 /product="uncharacterized protein LOC121112685 isoform X1" /protein_id="XP_046761974.1" /db_xref="GeneID:121112685" /db_xref="CGNC:92539" /translation="
MRAQFASGTLTDLQRVNLLEELLQAHERAVEKRKAEARESLMKDAQQIREERTTATKDELDQEKQLIAQLEQQLQAGRKEIKVVWRGEGIGAARPCMGTWRATAAGTGTHAFVCQVLRQEKERLQQEREELELERCLLGTWCARGWARTAGEPAC"
misc_feature <658..>873 /gene="LOC121112685" /note="recombination and DNA strand exchange inhibitor protein; Reviewed; Region: PRK00409" /db_xref="CDD:234750" ORIGIN
acagcgtgggacgacgcgccatgagagcatccaaaggggacagccgcgctgaagcgcggttgttatggatacacagccacgcgtgcgccgtcgtcacgcggacggctgtacgccgtgccatgaatgagggcgcgccgtcgccgtcgccgtcgcaacgcagctgagtgacgtcctggcagatagaacaaaccaggtgtgagcactgtctttccaaagttacactgaagccgttggaggaaaggtcggacctcaggccttcccgcggcaccaactactgacggcggatttgctcacagatccttcacagctgtttcaaagaaccattctgtgattctatgatcttccaggacccttccaagccacaccatcctgtggttctatcatcttccaggactcttccaacacaaaccattctatggttctgtgatcactaaggaacctcccaagccacgccgtcctgcagttctatgatcttccaggaccctcctgtgcgggtgatgtcacaatgatgtgatgacctcacagaggccctggggtggggcaggggcagtgggtcagcgctgaacctgcctgcctcattctgcggttggttctggtccagcgaggagctgtgcgagtggtgcagcaatgcgggcccagtttgccagcgggacattaacagatctgcagcgtgtgaatctgctggaggagctgctgcaggctcatgagcgcgccgtggagaagcgcaaggctgaggccagggaatccttgatgaaggatgcccagcaaatacgggaagaaagaacgactgccacgaaagatgagctggatcaggagaagcagctcattgcccagctggaacagcagctgcaggctgggagaaaggagatcaaggtagtgtggaggggcgagggaatcggggctgcccgcccctgcatggggacctggagggcaactgcagcgggcacgggcactcacgcttttgtctgccaggtgctgcgccaggaaaaagagcgcctgcaacaggagcgggaggagctggagcttgagaggtgcctgttgggcacatggtgtgcacgggggtgggcacgcactgctggggagcccgcgtgctga
//
by
@meso_cacase at
DBCLS
This page is licensed under a
Creative Commons Attribution 4.0 International License (CC BY 4.0).
If you use GGRNA in your work, please cite:
Naito Y, Bono H. (2012)
GGRNA: an ultrafast, transcript-oriented search engine for genes and transcripts.
Nucleic Acids Res., 40, W592-W596.
[Full Text]