LOCUS       XM_040647312            1990 bp    mRNA    linear   VRT 01-MAR-2022
DEFINITION  PREDICTED: Gallus gallus eukaryotic translation initiation factor 2
            alpha kinase 1 (EIF2AK1), transcript variant X3, mRNA.
ACCESSION   XM_040647312
VERSION     XM_040647312.2
DBLINK      BioProject: PRJNA698609
KEYWORDS    RefSeq.
SOURCE      Gallus gallus (chicken)
  ORGANISM  Gallus gallus
            Eukaryota; Metazoa; Chordata; Craniata; Vertebrata; Euteleostomi;
            Archelosauria; Archosauria; Dinosauria; Saurischia; Theropoda;
            Coelurosauria; Aves; Neognathae; Galloanserae; Galliformes;
            Phasianidae; Phasianinae; Gallus.
COMMENT     MODEL REFSEQ:  This record is predicted by automated computational
            analysis. This record is derived from a genomic sequence
            (NC_052545.1) annotated using gene prediction method: Gnomon,
            supported by mRNA and EST evidence.
            Also see:
                Documentation of NCBI's Annotation Process
            
            On Mar 1, 2022 this sequence version replaced XM_040647312.1.
            
            ##Genome-Annotation-Data-START##
            Annotation Provider         :: NCBI
            Annotation Status           :: Full annotation
            Annotation Name             :: Gallus gallus Annotation Release 106
            Annotation Version          :: 106
            Annotation Pipeline         :: NCBI eukaryotic genome annotation
                                           pipeline
            Annotation Software Version :: 9.0
            Annotation Method           :: Best-placed RefSeq; Gnomon
            Features Annotated          :: Gene; mRNA; CDS; ncRNA
            ##Genome-Annotation-Data-END##
FEATURES             Location/Qualifiers
     source          1..1990
                     /organism="Gallus gallus"
                     /mol_type="mRNA"
                     /isolate="bGalGal1"
                     /db_xref="taxon:9031"
                     /chromosome="14"
                     /sex="female"
                     /tissue_type="blood"
                     /country="USA: Fayetteville"
                     /lat_lon="36.0822 N 94.1719 W"
                     /collection_date="20-May-2019"
                     /collected_by="Nick Anthony"
     gene            1..1990
                     /gene="EIF2AK1"
                     /note="eukaryotic translation initiation factor 2 alpha
                     kinase 1; Derived by automated computational analysis
                     using gene prediction method: Gnomon. Supporting evidence
                     includes similarity to: 1 mRNA, 8 ESTs, 30 long SRA reads,
                     and 100% coverage of the annotated genomic feature by
                     RNAseq alignments, including 48 samples with support for
                     all annotated introns"
                     /db_xref="CGNC:2470"
                     /db_xref="GeneID:395360"
     misc_feature    1
                     /gene="EIF2AK1"
                     /experiment="COORDINATES: cap analysis [ECO:0007248]"
                     /note="transcription start site"
     CDS             248..1915
                     /gene="EIF2AK1"
                     /codon_start=1
                     /product="eukaryotic translation initiation factor 2-alpha
                     kinase 1 isoform X3"
                     /protein_id="XP_040503246.1"
                     /db_xref="GeneID:395360"
                     /db_xref="CGNC:2470"
                     /translation="

MWDVSPEICSFVLRQAFTRTGLLSPFAFCDEFSTVRLQHNRAITELMKAANRQVLNGELDNGDSRAIGEKEVLLEAQTSRYLNEFDEIARLGKGGYGQVYKVRNKLDGQFYAIKKINIKKATRRDCMKVLREVKVLAGLQHPNIVGYHTAWMEHVQTACPKDKTVLKLQSLPLEQESGDDHCHIQSVESGSSIIFADLTSQEEKSGDSTCLRNPDGESVQNMDVRNDFTNSNSKEICMKPNRCELPIELQEDSDSSVDCRSTDLKHDSSYDPPCSLDLDASAGSKSCTEECSGNDVALCGEFEVEYRLMLYIQMQLCELSLWDWIAARNKRCNERTEDAAGLYHLVDVSWTMKIFEELLEGVCYIHSMGVMHRDIKPRNIFLHGSDHQVKIGDFGLACKDLLWDDADQWFHTERINGLTHTSGVGTCLYASPEQLQGSDYDFKSDMYSLGVILLELFQPFGTEMERAEVITNLRNGHIPHNFCKKWPVQAKYVKLLTSQVSTERPTAAQLRESELFHTTEHQKVREQEEEIEKLKEKLRLLSTGQDEHMKQGSPV"

     misc_feature    479..1789
                     /gene="EIF2AK1"
                     /note="Catalytic domain of the Serine/Threonine kinase,
                     eukaryotic translation Initiation Factor 2-Alpha Kinase 2
                     or Heme-Regulated Inhibitor kinase; Region:
                     STKc_EIF2AK1_HRI; cd14049"
                     /db_xref="CDD:270951"
     misc_feature    order(479..487,494..499,635..640,647..652,656..661,
                     683..709,713..715,1175..1177,1337..1339,1346..1354)
                     /gene="EIF2AK1"
                     /note="dimer interface [polypeptide binding]; other site"
                     /db_xref="CDD:270951"
     misc_feature    497..>1066
                     /gene="EIF2AK1"
                     /note="Protein Kinases, catalytic domain; Region:
                     PKc_like; cl21453"
                     /db_xref="CDD:451246"
     misc_feature    order(518..523,536..538,542..544,581..583,587..589,
                     1187..1198,1205..1207,1379..1384,1388..1390,1424..1426,
                     1523..1531,1622..1624,1628..1651)
                     /gene="EIF2AK1"
                     /note="active site"
                     /db_xref="CDD:270951"
     misc_feature    order(518..523,536..538,542..544,581..583,587..589,
                     680..682,1187..1198,1205..1207,1367..1369,1373..1375,
                     1379..1384,1388..1390,1424..1426)
                     /gene="EIF2AK1"
                     /note="ATP binding site [chemical binding]; other site"
                     /db_xref="CDD:270951"
     misc_feature    order(518..529,536..538,542..544,581..583,587..589,
                     680..682,803..805,806..808,914..916,923..925,929..931,
                     1031..1036)
                     /gene="EIF2AK1"
                     /note="ATP binding site [chemical binding]; other site"
                     /db_xref="CDD:270870"
     misc_feature    order(1421..1450,1496..1531)
                     /gene="EIF2AK1"
                     /note="activation loop (A-loop); other site"
                     /db_xref="CDD:270951"
     misc_feature    order(1523..1531,1622..1624,1628..1651)
                     /gene="EIF2AK1"
                     /note="eIF2alpha (substrate) binding site [polypeptide
                     binding]; other site"
                     /db_xref="CDD:270951"
     polyA_site      1990
                     /gene="EIF2AK1"
                     /experiment="COORDINATES: polyA evidence [ECO:0006239]"
ORIGIN      

acaggaaggaaagcaaaagcaaggtagtttgcttgagggagcttaggctctgcggtgatataaaatgggatctaaaaacacagataaaagaggggcttgttagaaatacttatcaggaaatagctgtggtatggtcttcgctgcgcctgccaagattatgttctgtgaaagtcagagtaaataatcttggaagtcccttattttccaacagagtcctttgacgtaattctagagcttgcgttcttagatgtgggatgtttctcctgaaatctgttcctttgtacttcgacaggctttcacgagaacaggtttgctctccccttttgccttctgtgatgaatttagtactgtaagactgcagcataatagagccattactgagctaatgaaagcagctaaccgacaagtgcttaatggggagcttgataatggagattctcgtgcaattggggaaaaagaagttctcttggaagcacagacatcacgatacttgaatgaatttgatgagattgcaagattaggaaaaggaggatatggccaagtatacaaggtcagaaacaagttagatggtcagttctatgctattaaaaaaatcaatattaagaaggctacaagaagagattgcatgaaggtgctacgagaggttaaagtgctggctggactgcagcatcctaatattgtgggctatcacactgcttggatggaacacgttcaaacagcttgcccaaaagataagacagtattgaagttgcagtcattacccttggaacaggagagtggagatgatcactgtcacattcagagtgtggaaagtggtagttcaattatttttgctgaccttacttcacaagaagaaaagtctggtgacagtacatgtcttagaaatccagatggtgaatcagtgcagaatatggatgtaaggaatgatttcactaacagcaatagtaaggaaatatgtatgaaaccaaatagatgtgaattacccatagaactacaagaagactctgacagtagtgttgactgtagatcaactgatttaaaacatgattcatcgtacgacccaccctgtagtctggatctagatgctagtgctggaagcaagtcctgcactgaagagtgctctgggaatgatgtagctctctgtggagagtttgaggtggagtatcgtttgatgctttatatacagatgcaactgtgtgaactgtccctgtgggactggattgctgcccgtaacaaaagatgcaatgagagaacagaggatgctgctggtctgtaccaccttgtggatgtcagctggacaatgaaaatttttgaagagttattagaaggagtgtgctatatccacagcatgggagtgatgcatcgagacattaaacccagaaatatctttttgcatggatcagatcatcaagttaaaataggagattttggattagcctgcaaagacctcctttgggatgatgcagaccagtggtttcacacagaaaggataaatggactgacacatacctcaggtgtggggacttgcctgtatgcttcaccagaacagctgcaggggtctgactacgacttcaagtcagacatgtacagcttgggtgttatcctgctagaactcttccagccatttggaacagaaatggaaagagcagaagttataacaaatttaaggaatggccacattcctcataacttctgcaagaaatggcctgttcaagccaagtatgtaaaacttctcaccagtcaggtatccacagaaagaccaactgctgctcaacttcgtgaaagtgagctgtttcataccacagaacatcaaaaggtgagagagcaagaagaagaaatagaaaaactgaaagagaaactaagactgctttctactggacaagatgaacatatgaaacaaggttctccggtttaagtacaggaagaacacaactattgtatattaagttatagaaaacagggtttttttacataaaaatagttcagtgca

//