2024-05-20 10:23:34, GGRNA.v2 : RefSeq release 222 (Jan, 2024)
LOCUS NM_205267 1268 bp mRNA linear VRT 23-SEP-2023 DEFINITION Gallus gallus nucleophosmin (NPM1), mRNA. ACCESSION NM_205267 VERSION NM_205267.2 KEYWORDS RefSeq. SOURCE Gallus gallus (chicken) ORGANISM Gallus gallus Eukaryota; Metazoa; Chordata; Craniata; Vertebrata; Euteleostomi; Archelosauria; Archosauria; Dinosauria; Saurischia; Theropoda; Coelurosauria; Aves; Neognathae; Galloanserae; Galliformes; Phasianidae; Phasianinae; Gallus. REFERENCE 1 (bases 1 to 1268) AUTHORS Tang H, Finn RD and Thomas PD. TITLE TreeGrafter: phylogenetic tree-based annotation of proteins with Gene Ontology terms and other annotations JOURNAL Bioinformatics 35 (3), 518-520 (2019) PUBMED 30032202 REFERENCE 2 (bases 1 to 1268) AUTHORS Duan Z, Chen J, Xu H, Zhu J, Li Q, He L, Liu H, Hu S and Liu X. TITLE The nucleolar phosphoprotein B23 targets Newcastle disease virus matrix protein to the nucleoli and facilitates viral replication JOURNAL Virology 452-453, 212-222 (2014) PUBMED 24606698 REMARK GeneRIF: Phosphoprotein B23 targets Newcastle disease virus matrix protein to the nucleoli and facilitates viral replication. REFERENCE 3 (bases 1 to 1268) AUTHORS Duan Z, Chen J, He L, Xu H, Li Q, Hu S and Liu X. TITLE [Matrix protein of Newcastle disease virus interacts with avian nucleophosmin B23. 1 in HEK-293T cells] JOURNAL Wei Sheng Wu Xue Bao 53 (7), 730-736 (2013) PUBMED 24195380 REMARK GeneRIF: Matrix protein of Newcastle disease virus interacts with chicken nucleophosmin B23.1. REFERENCE 4 (bases 1 to 1268) AUTHORS Mukudai Y, Kubota S, Kawaki H, Kondo S, Eguchi T, Sumiyoshi K, Ohgawara T, Shimo T and Takigawa M. TITLE Posttranscriptional regulation of chicken ccn2 gene expression by nucleophosmin/B23 during chondrocyte differentiation JOURNAL Mol Cell Biol 28 (19), 6134-6147 (2008) PUBMED 18678650 REMARK GeneRIF: The present study reveals a novel aspect of NPM/B23 as a key player in the posttranscriptional regulation of ccn2 mRNA during the differentiation of chondrocytes. REFERENCE 5 (bases 1 to 1268) AUTHORS Hubbard SJ, Grafham DV, Beattie KJ, Overton IM, McLaren SR, Croning MD, Boardman PE, Bonfield JK, Burnside J, Davies RM, Farrell ER, Francis MD, Griffiths-Jones S, Humphray SJ, Hyland C, Scott CE, Tang H, Taylor RG, Tickle C, Brown WR, Birney E, Rogers J and Wilson SA. TITLE Transcriptome analysis for the chicken based on 19,626 finished cDNA sequences and 485,337 expressed sequence tags JOURNAL Genome Res 15 (1), 174-183 (2005) PUBMED 15590942 REFERENCE 6 (bases 1 to 1268) AUTHORS Maridor G, Krek W and Nigg EA. TITLE Structure and developmental expression of chicken nucleolin and NO38: coordinate expression of two abundant non-ribosomal nucleolar proteins JOURNAL Biochim Biophys Acta 1049 (2), 126-133 (1990) PUBMED 2114180 REFERENCE 7 (bases 1 to 1268) AUTHORS Maridor G and Nigg EA. TITLE cDNA sequences of chicken nucleolin/C23 and NO38/B23, two major nucleolar proteins JOURNAL Nucleic Acids Res 18 (5), 1286 (1990) PUBMED 2320420 REFERENCE 8 (bases 1 to 1268) AUTHORS Borer RA, Lehner CF, Eppenberger HM and Nigg EA. TITLE Major nucleolar proteins shuttle between nucleus and cytoplasm JOURNAL Cell 56 (3), 379-390 (1989) PUBMED 2914325 COMMENT PROVISIONAL REFSEQ: This record has not yet been subject to final NCBI review. The reference sequence was derived from JAENSK010000256.1. On Sep 23, 2021 this sequence version replaced NM_205267.1. ##Evidence-Data-START## Transcript exon combination :: HAEK01012407.1, HAEK01009853.1 [ECO:0000332] RNAseq introns :: single sample supports all introns SAMEA103992290, SAMEA103992323 [ECO:0000348] ##Evidence-Data-END## PRIMARY REFSEQ_SPAN PRIMARY_IDENTIFIER PRIMARY_SPAN COMP 1-127 JAENSK010000256.1 1518579-1518705 c 128-207 JAENSK010000256.1 1517973-1518052 c 208-327 JAENSK010000256.1 1515094-1515213 c 328-421 JAENSK010000256.1 1514373-1514466 c 422-525 JAENSK010000256.1 1513755-1513858 c 526-587 JAENSK010000256.1 1513215-1513276 c 588-642 JAENSK010000256.1 1512778-1512832 c 643-732 JAENSK010000256.1 1511598-1511687 c 733-834 JAENSK010000256.1 1510689-1510790 c 835-909 JAENSK010000256.1 1508837-1508911 c 910-1268 JAENSK010000256.1 1507498-1507856 c FEATURES Location/Qualifiers source 1..1268 /organism="Gallus gallus" /mol_type="mRNA" /db_xref="taxon:9031" /chromosome="13" /map="13" gene 1..1268 /gene="NPM1" /gene_synonym="NO38" /note="nucleophosmin" /db_xref="CGNC:49698" /db_xref="GeneID:396203" exon 1..127 /gene="NPM1" /gene_synonym="NO38" /inference="alignment:Splign:2.1.0" CDS 64..948 /gene="NPM1" /gene_synonym="NO38" /note="nucleolar phosphoprotein B23; NPM; numatrin; nucleolar protein NO38; nucleophosmin (nucleolar phosphoprotein B23, numatrin)" /codon_start=1 /product="nucleophosmin" /protein_id="NP_990598.2" /db_xref="CGNC:49698" /db_xref="GeneID:396203" /translation="
MEDSAMDMESMGPLRPQTFLFGCELKAEKEYQFKVDDEENEHQLSLRTVTLGAGAKDELHVVEAEALDYEGNPTKVVLASLKMSVQPTVSLGGFEITPPVVLRLKCGSGPVYVSGQHLVALEEEPESEDEEEDTKIGNASTKRPASGGGAKTPQKKPKLSEDDEDDDEDEDDDEDDEDDLDDDEEEIKTPMKKPAREPAGKNMQKAKQNGKDSKPSTPASKTKTPDSKKDKSLTPKTPKVPLSLEEIKAKMQASVDKGCSLPKLEPKFANYVKNCFRTEDQKVIQALWQWRQTL"
misc_feature 121..420 /gene="NPM1" /gene_synonym="NO38" /note="Nucleoplasmin/nucleophosmin domain; Region: Nucleoplasmin; pfam03066" /db_xref="CDD:427119" misc_feature 232..234 /gene="NPM1" /gene_synonym="NO38" /note="Interaction between pentamers. /evidence=ECO:0000250; propagated from UniProtKB/Swiss-Prot (P16039.1); other site" misc_feature 307..309 /gene="NPM1" /gene_synonym="NO38" /note="Interaction between pentamers. /evidence=ECO:0000250; propagated from UniProtKB/Swiss-Prot (P16039.1); other site" misc_feature 424..795 /gene="NPM1" /gene_synonym="NO38" /note="propagated from UniProtKB/Swiss-Prot (P16039.1); Region: Disordered. /evidence=ECO:0000256|SAM:MobiDB-lite" misc_feature 520..537 /gene="NPM1" /gene_synonym="NO38" /note="propagated from UniProtKB/Swiss-Prot (P16039.1); Region: Nuclear localization signal. /evidence=ECO:0000255" misc_feature 631..651 /gene="NPM1" /gene_synonym="NO38" /note="propagated from UniProtKB/Swiss-Prot (P16039.1); Region: Nuclear localization signal. /evidence=ECO:0000255" misc_feature 796..942 /gene="NPM1" /gene_synonym="NO38" /note="Nucleophosmin C-terminal domain; Region: NPM1-C; pfam16276" /db_xref="CDD:435252" exon 128..207 /gene="NPM1" /gene_synonym="NO38" /inference="alignment:Splign:2.1.0" exon 208..327 /gene="NPM1" /gene_synonym="NO38" /inference="alignment:Splign:2.1.0" exon 328..421 /gene="NPM1" /gene_synonym="NO38" /inference="alignment:Splign:2.1.0" exon 422..525 /gene="NPM1" /gene_synonym="NO38" /inference="alignment:Splign:2.1.0" exon 526..587 /gene="NPM1" /gene_synonym="NO38" /inference="alignment:Splign:2.1.0" exon 588..642 /gene="NPM1" /gene_synonym="NO38" /inference="alignment:Splign:2.1.0" exon 643..732 /gene="NPM1" /gene_synonym="NO38" /inference="alignment:Splign:2.1.0" exon 733..834 /gene="NPM1" /gene_synonym="NO38" /inference="alignment:Splign:2.1.0" exon 835..909 /gene="NPM1" /gene_synonym="NO38" /inference="alignment:Splign:2.1.0" exon 910..1268 /gene="NPM1" /gene_synonym="NO38" /inference="alignment:Splign:2.1.0" ORIGIN
agtgcgcgtccgtccgcagcgccgcatcccgtacagctcctcccgcgcgagcaggccgagaagatggaggacagcgccatggacatggagagcatgggcccgctgcgcccgcagaccttcctcttcggctgcgagcttaaagcagagaaggaatatcagttcaaagtagatgatgaggaaaacgagcatcagctgtccttgagaacggttacattaggggctggagccaaagacgaattacatgttgtagaagcagaagcactggactacgaaggcaacccaactaaagtagtactggcatctctgaaaatgtctgtgcagcctacagtttcactaggtggatttgagatcacaccaccagttgtcttgaggttaaaatgtggttcggggcctgtttatgtcagtggtcagcatcttgtagcattagaggaagagccagaatcagaggatgaggaggaggatacaaaaatagggaatgcttcaacaaagagaccagcaagtggaggaggagctaaaacaccacagaaaaaaccaaaattatcagaagatgatgaggacgatgatgaagatgaggatgatgatgaggatgatgaagacgacttggatgatgatgaggaggagattaaaacaccaatgaagaaacctgcccgcgagcctgcaggaaaaaatatgcagaaagcaaagcaaaatggaaaagactcaaagccgtccacaccagcatctaaaacaaaaactccagattccaagaaggacaaatctctaactccaaaaacaccgaaagttcctctgtcgttagaggagatcaaagcaaaaatgcaggcctccgtagacaagggttgttcccttcctaagctggagcccaaatttgccaactatgttaagaattgcttcaggacggaggaccaaaaggtcattcaagctctctggcagtggagacagactctgtaagagaacaatttaaacagtttgttaaagtctgcagtcttacttctgtaaccattatttggctgttctttttacaaatgctgaaagagctttccctacagtgtctgataaatgtcatccagattaccttgccaagaatgtgttgtccaaaatgcctgtttagtttttaaagatgggactccaccctcagcttcattttaagtatgtatggaatgttttgataaggcatggtggtgtggtggtggtggtcagacaaatggaagtggtgggaagactaaatgtacgtggaaaaaaaaaataaaatttagtattttaataaagta
//
by
@meso_cacase at
DBCLS
This page is licensed under a
Creative Commons Attribution 4.0 International License (CC BY 4.0).
If you use GGRNA in your work, please cite:
Naito Y, Bono H. (2012)
GGRNA: an ultrafast, transcript-oriented search engine for genes and transcripts.
Nucleic Acids Res., 40, W592-W596.
[Full Text]