GGRNA ver.2 Home | Help | Advanced search    Previous release (v1)

2024-05-20 08:18:34, GGRNA.v2 : RefSeq release 222 (Jan, 2024)

LOCUS       NM_001277112            1063 bp    mRNA    linear   VRT 23-SEP-2023
DEFINITION  Gallus gallus mitochondrial ribosomal protein L46 (MRPL46), mRNA.
ACCESSION   NM_001277112 XM_413872
VERSION     NM_001277112.2
KEYWORDS    RefSeq.
SOURCE      Gallus gallus (chicken)
  ORGANISM  Gallus gallus
            Eukaryota; Metazoa; Chordata; Craniata; Vertebrata; Euteleostomi;
            Archelosauria; Archosauria; Dinosauria; Saurischia; Theropoda;
            Coelurosauria; Aves; Neognathae; Galloanserae; Galliformes;
            Phasianidae; Phasianinae; Gallus.
REFERENCE   1  (bases 1 to 1063)
  AUTHORS   Tang H, Finn RD and Thomas PD.
  TITLE     TreeGrafter: phylogenetic tree-based annotation of proteins with
            Gene Ontology terms and other annotations
  JOURNAL   Bioinformatics 35 (3), 518-520 (2019)
   PUBMED   30032202
COMMENT     VALIDATED REFSEQ: This record has undergone validation or
            preliminary review. The reference sequence was derived from
            JAENSK010000245.1.
            
            On Sep 23, 2021 this sequence version replaced NM_001277112.1.
            
            Sequence Note: This RefSeq record was created from transcript and
            genomic sequence data to make the sequence consistent with the
            reference genome assembly. The genomic coordinates used for the
            transcript record were based on transcript alignments.
            
            ##Evidence-Data-START##
            Transcript exon combination :: DR420175.1, BU329558.1 [ECO:0000332]
            RNAseq introns              :: single sample supports all introns
                                           SAMEA103992290, SAMEA103992323
                                           [ECO:0000348]
            ##Evidence-Data-END##
            
            ##RefSeq-Attributes-START##
            gene product(s) localized to mito. :: inferred from homology
            ##RefSeq-Attributes-END##
            COMPLETENESS: complete on the 3' end.
PRIMARY     REFSEQ_SPAN         PRIMARY_IDENTIFIER PRIMARY_SPAN        COMP
            1-250               JAENSK010000245.1  12726060-12726309
            251-446             JAENSK010000245.1  12726565-12726760
            447-620             JAENSK010000245.1  12727311-12727484
            621-1063            JAENSK010000245.1  12728139-12728581
FEATURES             Location/Qualifiers
     source          1..1063
                     /organism="Gallus gallus"
                     /mol_type="mRNA"
                     /db_xref="taxon:9031"
                     /chromosome="10"
                     /map="10"
     gene            1..1063
                     /gene="MRPL46"
                     /note="mitochondrial ribosomal protein L46"
                     /db_xref="CGNC:5117"
                     /db_xref="GeneID:415499"
     exon            1..250
                     /gene="MRPL46"
                     /inference="alignment:Splign:2.1.0"
     CDS             11..871
                     /gene="MRPL46"
                     /codon_start=1
                     /product="large ribosomal subunit protein mL46"
                     /protein_id="NP_001264041.1"
                     /db_xref="CGNC:5117"
                     /db_xref="GeneID:415499"
                     /translation="
MAALGGKMAAPSSGLCGFRRSAMAARVWWAAGCGRRLSTAPPAAAPRPWKLFGALCLLRLPRITQPLRKEEEEMAALMEQIELEKSHYSDHEIRKLEEEEQLRRRKESLHDDDNEGLGRTVVMAQDLEEKWEQKLLQFSPAPRVTDADKKNDRTSLNRKLDSNLMLLVKQKIGNQELWLLPQVEWQPGETLRSTVERAMATFLGDHIQAKILGNAPYGIYKYKFPRAIRTEDNVGAKVFFYKAFLQSSDLSQAELKKDYLWVTKDELGDYLKSEYLKKVNRFLLDL"
     misc_feature    155..454
                     /gene="MRPL46"
                     /note="39S mitochondrial ribosomal protein L46; Region:
                     MRP-L46; pfam11788"
                     /db_xref="CDD:432074"
     misc_feature    461..856
                     /gene="MRPL46"
                     /note="Nudix hydrolase is a superfamily of enzymes found
                     in all three kingdoms of life, and it catalyzes the
                     hydrolysis of NUcleoside DIphosphates linked to other
                     moieties, X. Enzymes belonging to this superfamily require
                     a divalent cation, such as Mg2+ or Mn2+...; Region:
                     Nudix_Hydrolase; cl00447"
                     /db_xref="CDD:444909"
     misc_feature    order(557..565,578..604)
                     /gene="MRPL46"
                     /note="nudix motif; other site"
                     /db_xref="CDD:239217"
     exon            251..446
                     /gene="MRPL46"
                     /inference="alignment:Splign:2.1.0"
     exon            447..620
                     /gene="MRPL46"
                     /inference="alignment:Splign:2.1.0"
     exon            621..1063
                     /gene="MRPL46"
                     /inference="alignment:Splign:2.1.0"
ORIGIN      
gggaggaaagatggcggcgctgggaggaaagatggctgcgcccagttcggggctctgcgggttccgccgaagcgcgatggcggcgcgcgtgtggtgggctgcggggtgcggccggcggctgagcaccgctcctcccgctgctgctccccggccgtggaagctcttcggggccctgtgcctgctgaggctgccccgcatcacgcagcccctccggaaggaggaagaggagatggcggccctcatggagcagatagagctggagaaaagccactactccgaccacgaaatccgcaagctggaggaggaggagcagctcagaaggaggaaggaaagcttgcatgatgatgacaacgaagggctgggcagaacggttgttatggctcaggacctggaggagaagtgggaacagaagctgctgcagttcagcccagccccgcgggttacagatgctgataaaaaaaacgatcgaacatcattgaacagaaagctggacagtaacctgatgttgctggtgaaacagaaaattggtaaccaagagctgtggctcctgcctcaagtggaatggcagcctggagagactctgcgaagcacagttgagcgagccatggctacgtttttaggcgatcacattcaagccaaaatcctggggaatgcaccatatgggatttacaagtataaattccccagggccatcaggactgaggataacgtgggagccaaagtattcttctacaaagccttcctccaaagcagtgatttgtcccaggcagagctgaagaaagattatctgtgggttacaaaggatgagctgggagattacttgaagtcggaatacctgaaaaaagtcaatcgattccttctggacttataagtgataggctgtgctcaggcagatggggaagatgtggaatgtgactctggggaggagcacagctgctgctttgtgtggtctgtgtgaatgggatgttaaacaggactctggaggataaattgcctttgccttatttcccagttctcttcaccaggcctgtattaaataaatattaaaactttatactcccaa
//

by @meso_cacase at DBCLS
This page is licensed under a Creative Commons Attribution 4.0 International License (CC BY 4.0).

If you use GGRNA in your work, please cite:
Naito Y, Bono H. (2012)
GGRNA: an ultrafast, transcript-oriented search engine for genes and transcripts.
Nucleic Acids Res., 40, W592-W596. [Full Text]