2024-05-03 22:28:27, GGRNA.v2 : RefSeq release 222 (Jan, 2024)
LOCUS NM_001048076 2040 bp mRNA linear VRT 23-SEP-2023 DEFINITION Gallus gallus vimentin (VIM), mRNA. ACCESSION NM_001048076 XM_418622 VERSION NM_001048076.3 KEYWORDS RefSeq. SOURCE Gallus gallus (chicken) ORGANISM Gallus gallus Eukaryota; Metazoa; Chordata; Craniata; Vertebrata; Euteleostomi; Archelosauria; Archosauria; Dinosauria; Saurischia; Theropoda; Coelurosauria; Aves; Neognathae; Galloanserae; Galliformes; Phasianidae; Phasianinae; Gallus. REFERENCE 1 (bases 1 to 2040) AUTHORS Yoshida Y, Wang Z, Tehrani KF, Pendleton EG, Tanaka R, Mortensen LJ, Nishimura S, Tabata S, Liu HX and Kawabata F. TITLE Bitter taste receptor T2R7 and umami taste receptor subunit T1R1 are expressed highly in Vimentin-negative taste bud cells in chickens JOURNAL Biochem Biophys Res Commun 511 (2), 280-286 (2019) PUBMED 30782484 REMARK GeneRIF: 3D-reconstructed images clearly revealed that high levels of taste receptor type 2 member 7 and T1R1 were expressed in Vimentin-negative taste bud cells. REFERENCE 2 (bases 1 to 2040) AUTHORS Tang H, Finn RD and Thomas PD. TITLE TreeGrafter: phylogenetic tree-based annotation of proteins with Gene Ontology terms and other annotations JOURNAL Bioinformatics 35 (3), 518-520 (2019) PUBMED 30032202 REFERENCE 3 (bases 1 to 2040) AUTHORS Walker JL, Bleaken BM, Romisher AR, Alnwibit AA and Menko AS. TITLE In wound repair vimentin mediates the transition of mesenchymal leader cells to a myofibroblast phenotype JOURNAL Mol Biol Cell 29 (13), 1555-1570 (2018) PUBMED 29718762 REMARK GeneRIF: These findings suggest a novel role for extracellular, cell-surface-associated vimentin in mediating repair-cell function in wound repair and in transitioning these cells to a myofibroblast phenotype. REFERENCE 4 (bases 1 to 2040) AUTHORS Kommata V and Dermon CR. TITLE Transient vimentin expression during the embryonic development of the chicken cerebellum JOURNAL Int J Dev Neurosci 65, 11-20 (2018) PUBMED 29030097 REMARK GeneRIF: The dats of this study support the possible role of vimentin+ fibers in the structural events of cerebellum corticogenesis, suggesting the participation of radial/Bergmann glia in chicken cerebellum foliation. REFERENCE 5 (bases 1 to 2040) AUTHORS Venkatesan N, Rajapaksha P, Payne J, Goodfellow F, Wang Z, Kawabata F, Tabata S, Stice S, Beckstead R and Liu HX. TITLE Distribution of alpha-Gustducin and Vimentin in premature and mature taste buds in chickens JOURNAL Biochem Biophys Res Commun 479 (2), 305-311 (2016) PUBMED 27639649 REMARK GeneRIF: analysis of alpha-Gustducin and Vimentin distribution in premature and mature taste buds in chickens REFERENCE 6 (bases 1 to 2040) AUTHORS Benes P, Maceckova V, Zdrahal Z, Konecna H, Zahradnickova E, Muzik J and Smarda J. TITLE Role of vimentin in regulation of monocyte/macrophage differentiation JOURNAL Differentiation 74 (6), 265-276 (2006) PUBMED 16831196 REMARK GeneRIF: These findings document that up-regulation of vimentin gene expression is important for formation of fully active macrophage-like cells and macrophage polykaryons REFERENCE 7 (bases 1 to 2040) AUTHORS Boardman PE, Sanz-Ezquerro J, Overton IM, Burt DW, Bosch E, Fong WT, Tickle C, Brown WR, Wilson SA and Hubbard SJ. TITLE A comprehensive collection of chicken cDNAs JOURNAL Curr Biol 12 (22), 1965-1969 (2002) PUBMED 12445392 REFERENCE 8 (bases 1 to 2040) AUTHORS Zehner,Z.E., Li,Y., Roe,B.A., Paterson,B.M. and Sax,C.M. TITLE The chicken vimentin gene. Nucleotide sequence, regulatory elements, and comparison to the hamster gene JOURNAL J Biol Chem 262 (17), 8112-8120 (1987) PUBMED 3036797 REFERENCE 9 (bases 1 to 2040) AUTHORS Zehner,Z.E. and Paterson,B.M. TITLE The chicken vimentin gene: aspects of organization and transcription during myogenesis JOURNAL Ann N Y Acad Sci 455, 79-94 (1985) PUBMED 3909887 REMARK Review article REFERENCE 10 (bases 1 to 2040) AUTHORS Zehner,Z.E. and Paterson,B.M. TITLE Characterization of the chicken vimentin gene: single copy gene producing multiple mRNAs JOURNAL Proc Natl Acad Sci U S A 80 (4), 911-915 (1983) PUBMED 6573660 COMMENT VALIDATED REFSEQ: This record has undergone validation or preliminary review. The reference sequence was derived from JAENSK010000036.1. On Sep 23, 2021 this sequence version replaced NM_001048076.2. Publication Note: This RefSeq record includes a subset of the publications that are available for this gene. Please see the Gene record to access additional publications. ##Evidence-Data-START## Transcript exon combination :: HAEK01043492.1, HAEL01000258.1 [ECO:0000332] RNAseq introns :: single sample supports all introns SAMEA2812696, SAMEA3109052 [ECO:0000348] ##Evidence-Data-END## PRIMARY REFSEQ_SPAN PRIMARY_IDENTIFIER PRIMARY_SPAN COMP 1-618 JAENSK010000036.1 11858718-11859335 c 619-679 JAENSK010000036.1 11858559-11858619 c 680-775 JAENSK010000036.1 11855109-11855204 c 776-937 JAENSK010000036.1 11854804-11854965 c 938-1063 JAENSK010000036.1 11854223-11854348 c 1064-1284 JAENSK010000036.1 11853386-11853606 c 1285-1328 JAENSK010000036.1 11853248-11853291 c 1329-1414 JAENSK010000036.1 11852738-11852823 c 1415-2040 JAENSK010000036.1 11851623-11852248 c FEATURES Location/Qualifiers source 1..2040 /organism="Gallus gallus" /mol_type="mRNA" /db_xref="taxon:9031" /chromosome="2" /map="2" gene 1..2040 /gene="VIM" /note="vimentin" /db_xref="CGNC:51275" /db_xref="GeneID:420519" exon 1..618 /gene="VIM" /inference="alignment:Splign:2.1.0" CDS 74..1456 /gene="VIM" /note="vimentin C-terminus" /codon_start=1 /product="vimentin" /protein_id="NP_001041541.2" /db_xref="CGNC:51275" /db_xref="GeneID:420519" /translation="
MSFTSSKNSSYRRMFGGGSRPSSGTRYITSSTRYSLGSALRPSSARYVSASPGGVYATKATSVRLRSSMPPMRMHDAVDFTLADAINTEFKANRTNEKVELQELNDRFANYIDKVRFLEQQNKILLAELEQLKGKGTSRLGDLYEEEMRELRRQVDQLTNDKARVEVERDNLADDIMRLREKLQEEMLQREEAESTLQSFRQDVDNASLARLDLERKVESLQEEIVFLKKLHDEEIRELQAQLQEQHIQIDMDVSKPDLTAALRDVRQQYESVAAKNLQEAEEWYKSKFADLSEAANRNNDALRQAKQEANEYRRQIQSLTCEVDALKGSNESLERQMREMEENFAVEAANYQDTIGRLQDEIQNMKEEMARHLREYQDLLNVKMALDIEIATYRKLLEGEESRINMPIPTFASLNLRETNIESQPIVDTHSKRTLLIKTVETRDGQVINETSQHHDDLE"
misc_feature 74..154 /gene="VIM" /note="propagated from UniProtKB/Swiss-Prot (P09654.2); Region: Disordered. /evidence=ECO:0000256|SAM:MobiDB-lite" misc_feature 77..340 /gene="VIM" /note="propagated from UniProtKB/Swiss-Prot (P09654.2); Region: Head" misc_feature 98..358 /gene="VIM" /note="Intermediate filament head (DNA binding) region; Region: Filament_head; pfam04732" /db_xref="CDD:428095" misc_feature 341..448 /gene="VIM" /note="propagated from UniProtKB/Swiss-Prot (P09654.2); Region: Coil 1A" misc_feature 359..1285 /gene="VIM" /note="Intermediate filament protein; Region: Filament; pfam00038" /db_xref="CDD:425436" misc_feature 449..514 /gene="VIM" /note="propagated from UniProtKB/Swiss-Prot (P09654.2); Region: Linker 1" misc_feature 515..790 /gene="VIM" /note="propagated from UniProtKB/Swiss-Prot (P09654.2); Region: Coil 1B" misc_feature 791..859 /gene="VIM" /note="propagated from UniProtKB/Swiss-Prot (P09654.2); Region: Linker 12" misc_feature 860..1276 /gene="VIM" /note="propagated from UniProtKB/Swiss-Prot (P09654.2); Region: Coil 2" misc_feature 1106..1108 /gene="VIM" /note="Stutter. /evidence=ECO:0000250; propagated from UniProtKB/Swiss-Prot (P09654.2); other site" misc_feature 1277..1453 /gene="VIM" /note="propagated from UniProtKB/Swiss-Prot (P09654.2); Region: Tail" exon 619..679 /gene="VIM" /inference="alignment:Splign:2.1.0" exon 680..775 /gene="VIM" /inference="alignment:Splign:2.1.0" exon 776..937 /gene="VIM" /inference="alignment:Splign:2.1.0" exon 938..1063 /gene="VIM" /inference="alignment:Splign:2.1.0" exon 1064..1284 /gene="VIM" /inference="alignment:Splign:2.1.0" exon 1285..1328 /gene="VIM" /inference="alignment:Splign:2.1.0" exon 1329..1414 /gene="VIM" /inference="alignment:Splign:2.1.0" exon 1415..2040 /gene="VIM" /inference="alignment:Splign:2.1.0" ORIGIN
gctcttcttcgcccgccgcgctccgagccccgctccgctcccggattacaaagccgctccgttcctcgccgccatgagcttcaccagcagcaagaactcctcgtaccgccgcatgttcggcgggggcagccggcccagcagcggcacccgctacatcacgtccagcacccgctattccctgggcagcgccctgcggcccagcagcgcccgctacgtgtccgcctcgcccggcggcgtgtacgccaccaaggcgacgtcggtgcggctgcggagcagcatgccgcccatgcggatgcacgacgccgtggacttcaccctggcggacgccatcaacacggagttcaaggcgaaccgcaccaacgagaaggtagagctgcaggagctcaacgaccgcttcgccaactacatcgacaaggtgcgcttcctggagcagcagaacaagatcctgctggccgagctggagcagctcaagggcaaaggcacgtcccgcttgggcgacctgtacgaggaggagatgcgggagctgcggcggcaggtggaccagctgaccaacgacaaggcccgcgtcgaggtggagcgcgacaacctggccgacgacatcatgcgcctgcgggagaagttgcaggaggagatgctgcagcgggaggaggccgagagcaccctgcagtccttccgacaggatgttgacaatgcctctctggcacgccttgatcttgagcgcaaagttgagtccctgcaagaagaaattgtcttcttgaagaagcttcatgatgaggaaatccgggaactgcaggctcaactccaggaacagcacatccaaatcgatatggatgtttctaagcctgatcttactgctgccctgcgcgatgttcgtcaacaatatgaaagcgttgctgctaagaatcttcaggaagctgaagagtggtacaagtccaaatttgcagatctctccgaagctgctaataggaacaatgatgccctgcgccaggccaaacaagaagctaatgaatatcgcagacagattcagtctctcacctgtgaagttgatgcccttaaaggaagtaatgaatccctggagcgccagatgcgtgaaatggaggagaattttgctgttgaagctgctaactaccaggacactattggccgcctgcaggatgagattcagaacatgaaggaagaaatggctcgccatcttcgtgagtaccaggacctgctgaatgtaaagatggctcttgatattgagattgctacctacagaaaactgctggagggagaagagagcaggattaacatgcctattccaacctttgcttctttgaacctgagagaaaccaacattgagtctcagccaattgttgacactcactcgaagaggacacttctaattaagaccgtggaaactagagatggacaggttattaatgaaacttcccagcatcacgatgacttggagtaaagctgaagtgaagatgcaaacttaatgcaggagaaattcttaccagcaaggttttaaaaagttcatgtcttaaaggaagaaacagctttcaagtgcctttctccagtttttccatgagcgcaagattattatgctaggaaataggtcttagatcttgcaaactgactctccctgaaggattagagtttacaatggagtctagtttacaaatagcaatatcttgtgctgcaatactgtttttaagtatctgaatttaataaaactgctttttccagcacagtatgagcaacctgtcgctacttcaataaatctttggaaaatggctcttgatgtgttctaatttaacttcatgactttctgcaaagccataacttaatgctggaattactatacggttgacaactccagtactgattgtgtggaatattgttttcagattaactagacaaattgtcttcccatctactgcttaggttttggaaccaattaaaatggactataactggcagatgcataatgtattgatacttatcagttgaataaaatgatacttcaagctaataaaaattaatcttgctttcata
//
by
@meso_cacase at
DBCLS
This page is licensed under a
Creative Commons Attribution 4.0 International License (CC BY 4.0).
If you use GGRNA in your work, please cite:
Naito Y, Bono H. (2012)
GGRNA: an ultrafast, transcript-oriented search engine for genes and transcripts.
Nucleic Acids Res., 40, W592-W596.
[Full Text]