GGRNA ver.2 Home | Help | Advanced search    Previous release (v1)

2025-09-16 20:27:55, GGRNA.v2 : RefSeq release 231 (Jul, 2025)

LOCUS       XR_012603516             333 bp    RNA     linear   PLN 25-JUN-2025
DEFINITION  PREDICTED: Curcuma longa uncharacterized LOC141848280
            (LOC141848280), transcript variant X2, misc_RNA.
ACCESSION   XR_012603516
VERSION     XR_012603516.1
DBLINK      BioProject: PRJNA1277305
KEYWORDS    RefSeq.
SOURCE      Curcuma longa (turmeric)
  ORGANISM  Curcuma longa
            Eukaryota; Viridiplantae; Streptophyta; Embryophyta; Tracheophyta;
            Spermatophyta; Magnoliopsida; Liliopsida; Zingiberales;
            Zingiberaceae; Curcuma.
COMMENT     MODEL REFSEQ:  This record is predicted by automated computational
            analysis. This record is derived from a genomic sequence
            (NC_133877) annotated using gene prediction method: Gnomon.
            Also see:
                Documentation of NCBI's Annotation Process
            
            ##Genome-Annotation-Data-START##
            Annotation Provider         :: NCBI RefSeq
            Annotation Status           :: Full annotation
            Annotation Name             :: GCF_044706935.1-RS_2025_06
            Annotation Pipeline         :: NCBI eukaryotic genome annotation
                                           pipeline
            Annotation Software Version :: 10.4
            Annotation Method           :: Gnomon; cmsearch; tRNAscan-SE
            Features Annotated          :: Gene; mRNA; CDS; ncRNA
            Annotation Date             :: 06/19/2025
            ##Genome-Annotation-Data-END##
FEATURES             Location/Qualifiers
     source          1..333
                     /organism="Curcuma longa"
                     /mol_type="transcribed RNA"
                     /cultivar="G26"
                     /db_xref="taxon:136217"
                     /chromosome="17"
                     /tissue_type="leaves"
                     /ecotype="Majalengka, Jawa Barat"
                     /geo_loc_name="Indonesia"
                     /lat_lon="6.9163 S 107.7713 E"
                     /collection_date="2023-08-23"
                     /collected_by="Institut Teknologi Bandung"
                     /genotype="G26"
     gene            1..333
                     /gene="LOC141848280"
                     /note="uncharacterized LOC141848280; Derived by automated
                     computational analysis using gene prediction method:
                     Gnomon. Supporting evidence includes similarity to: 100%
                     coverage of the annotated genomic feature by RNAseq
                     alignments, including 2 samples with support for all
                     annotated introns"
                     /db_xref="GeneID:141848280"
     misc_RNA        1..333
                     /gene="LOC141848280"
                     /product="uncharacterized LOC141848280, transcript variant
                     X2"
                     /db_xref="GeneID:141848280"
ORIGIN      
aatgaaaaaaagagataatgaaattaaaaaattgcaaagacaacaatctcgcatcttgcaacattttcagttgcaatctcttcttggtgacgacgacgacgacgacgacgaccacgatgacgccagtgacgatggtggtgatacttcatgagttttttgcgtggtttttgtaaacaaatcaaaaaaaaaaggcgaataaaagatagtgacgaagaatccagtagagtttctgggggaccacgatgatcttcttcctatcttttattcatatctcatctgatttgtttagactttgtatggattagttggatttttctgatactttgactttgt
//

by @meso_cacase at DBCLS
This page is licensed under a Creative Commons Attribution 4.0 International License (CC BY 4.0).

If you use GGRNA in your work, please cite:
Naito Y, Bono H. (2012)
GGRNA: an ultrafast, transcript-oriented search engine for genes and transcripts.
Nucleic Acids Res., 40, W592-W596. [Full Text]