GGRNA ver.2 Home | Help | Advanced search    Previous release (v1)

2025-09-16 20:27:57, GGRNA.v2 : RefSeq release 231 (Jul, 2025)

LOCUS       XR_012488168             405 bp    RNA     linear   MAM 03-JUN-2025
DEFINITION  PREDICTED: Sminthopsis crassicaudata uncharacterized LOC141561823
            (LOC141561823), ncRNA.
ACCESSION   XR_012488168
VERSION     XR_012488168.1
DBLINK      BioProject: PRJNA1266204
KEYWORDS    RefSeq.
SOURCE      Sminthopsis crassicaudata (fat-tailed dunnart)
  ORGANISM  Sminthopsis crassicaudata
            Eukaryota; Metazoa; Chordata; Craniata; Vertebrata; Euteleostomi;
            Mammalia; Metatheria; Dasyuromorphia; Dasyuridae; Sminthopsis.
COMMENT     MODEL REFSEQ:  This record is predicted by automated computational
            analysis. This record is derived from a genomic sequence
            (NC_133619) annotated using gene prediction method: Gnomon.
            Also see:
                Documentation of NCBI's Annotation Process
            
            ##Genome-Annotation-Data-START##
            Annotation Provider         :: NCBI RefSeq
            Annotation Status           :: Full annotation
            Annotation Name             :: GCF_048593235.1-RS_2025_05
            Annotation Pipeline         :: NCBI eukaryotic genome annotation
                                           pipeline
            Annotation Software Version :: 10.4
            Annotation Method           :: Gnomon; cmsearch; tRNAscan-SE
            Features Annotated          :: Gene; mRNA; CDS; ncRNA
            Annotation Date             :: 05/29/2025
            ##Genome-Annotation-Data-END##
FEATURES             Location/Qualifiers
     source          1..405
                     /organism="Sminthopsis crassicaudata"
                     /mol_type="transcribed RNA"
                     /isolate="SCR6"
                     /db_xref="taxon:9301"
                     /chromosome="3"
                     /sex="female"
                     /tissue_type="fibroblast"
                     /geo_loc_name="Australia: Melbourne"
     gene            1..405
                     /gene="LOC141561823"
                     /note="uncharacterized LOC141561823; Derived by automated
                     computational analysis using gene prediction method:
                     Gnomon. Supporting evidence includes similarity to: 100%
                     coverage of the annotated genomic feature by RNAseq
                     alignments, including 1 sample with support for all
                     annotated introns"
                     /db_xref="GeneID:141561823"
     ncRNA           1..405
                     /ncRNA_class="lncRNA"
                     /gene="LOC141561823"
                     /product="uncharacterized LOC141561823"
                     /db_xref="GeneID:141561823"
ORIGIN      
taaagttctgtttgtatagagtgtctattagaagctttgcatctgtggttagcagaccgtaacctagaactgtcactttgctggtcgatattctcctaggaaacaaaatacagaagaaattttaaatagtgacttcaaatatgatgaggacaagtctagatgaagaactcagagaaatagcccacattcaaagtggcacagaatggacctcattcaatatttccaaggtatcctggagttgttggacagcaaacaatgtatcaaacatttctcaggcctttctgaagccatcctggatctcaggaagacgaccacttttcagatggacaatggtagcattcttatgaattctcaaaagacaatctcttcttgccatataacctggaatactttagtcaccttttg
//

by @meso_cacase at DBCLS
This page is licensed under a Creative Commons Attribution 4.0 International License (CC BY 4.0).

If you use GGRNA in your work, please cite:
Naito Y, Bono H. (2012)
GGRNA: an ultrafast, transcript-oriented search engine for genes and transcripts.
Nucleic Acids Res., 40, W592-W596. [Full Text]