GGRNA ver.2 Home | Help | Advanced search    Previous release (v1)

2026-01-19 00:19:58, GGRNA.v2 : RefSeq release 232 (Sep, 2025)

LOCUS       XM_036144920            2495 bp    mRNA    linear   VRT 10-SEP-2020
DEFINITION  PREDICTED: Fundulus heteroclitus testis and ovary specific PAZ
            domain containing 1 (topaz1), mRNA.
ACCESSION   XM_036144920
VERSION     XM_036144920.1
DBLINK      BioProject: PRJNA615222
KEYWORDS    RefSeq.
SOURCE      Fundulus heteroclitus (mummichog)
  ORGANISM  Fundulus heteroclitus
            Eukaryota; Metazoa; Chordata; Craniata; Vertebrata; Euteleostomi;
            Actinopterygii; Neopterygii; Teleostei; Neoteleostei;
            Acanthomorphata; Ovalentaria; Atherinomorphae; Cyprinodontiformes;
            Fundulidae; Fundulus.
COMMENT     MODEL REFSEQ:  This record is predicted by automated computational
            analysis. This record is derived from a genomic sequence
            (NC_046373.1) annotated using gene prediction method: Gnomon.
            Also see:
                Documentation of NCBI's Annotation Process
            
            ##Genome-Annotation-Data-START##
            Annotation Provider         :: NCBI
            Annotation Status           :: Full annotation
            Annotation Name             :: Fundulus heteroclitus Annotation
                                           Release 102
            Annotation Version          :: 102
            Annotation Pipeline         :: NCBI eukaryotic genome annotation
                                           pipeline
            Annotation Software Version :: 8.5
            Annotation Method           :: Best-placed RefSeq; Gnomon
            Features Annotated          :: Gene; mRNA; CDS; ncRNA
            ##Genome-Annotation-Data-END##
FEATURES             Location/Qualifiers
     source          1..2495
                     /organism="Fundulus heteroclitus"
                     /mol_type="mRNA"
                     /isolate="FHET01"
                     /db_xref="taxon:8078"
                     /chromosome="13"
                     /sex="male"
                     /tissue_type="pool"
                     /dev_stage="adult"
     gene            1..2495
                     /gene="topaz1"
                     /note="Derived by automated computational analysis using
                     gene prediction method: Gnomon. Supporting evidence
                     includes similarity to: 100% coverage of the annotated
                     genomic feature by RNAseq alignments, including 5 samples
                     with support for all annotated introns"
                     /db_xref="GeneID:105931937"
     CDS             343..2055
                     /gene="topaz1"
                     /codon_start=1
                     /product="protein TOPAZ1"
                     /protein_id="XP_036000813.1"
                     /db_xref="GeneID:105931937"
                     /translation="
MCRFQHLPVEGDEKFCVDAVAKFSKHPACLLKAGAVFTGYYQNSPPGAYFSMPVLLTLLWALLKAGMVSHVFSVLHVSLAHKLVPDHEFLLALFNYVRDKGLQSLIPELMELTFKMAGVGLELDLDWMENVKNTPMFQQTAQQTSHDALVGNHNPELLNLLHGIVEIELCVKQEDWKRMGEVYKALCQFSQHPNQVERISGRVAVALLSESKDKVSLPFAAFAETACQGESGENLVKSFLGRIGVTLMLRYHKNQHWTKGCRVVEVMSVLKVDYTVLKSLFGNEHGVSRCYIISVAAELFFLSGSVEGALKTLREHNWFLSSSSWPCEPADLERRTNVLRRLAGKTSYRDTLEVLCNLPGVKEPNDLIDISRYSPLFASHLQVCVERQVLPVASDTLDFMLCKKLAVEHPLLQAVLDKLGKQNLWLRARELFKHSLNVGYYPGVSAAPGSMALIVPCQLGEVELAITLEMFVALNASAILPLSDTATGPPLSITLRRTLSCEVEYISAGNRLLSAACLPQPKLTVHYIEVNSSQEQVFRLHVPTAHRWLRHNHSWASEMWTQQAKCLNPN"
     misc_feature    841..1365
                     /gene="topaz1"
                     /note="Putative aspartate racemase; Region:
                     Asp_Glu_race_2; pfam14669"
                     /db_xref="CDD:464250"
ORIGIN      
cagccagtggcagcggctcttgaagacgacgaggagagcgaaagcaggccgtggagacctcggtgtggcggcgtctctaccagaggtccaaacccgtgtcccgtcgccgtcagccagagcagacacgtgggcccctccggcgaaaacagtaggatagatggcaaatgtaatcttggtcaacccatcaagaaagtgagcttctcccacagcgtccccccagtcacggccttacaaacgggacccgctgtgaaaaccccagcgactaggacagatcctaggtgccagaaatctaatgtttactgcagactgtacttcagtgaatcgctgtcctgtggctacaaaatgtgtcgcttccagcatctaccagtggagggggatgagaagttctgtgttgacgctgtggcaaagttctccaaacatccagcttgcctcctgaaagcaggagctgtgtttacagggtactaccagaacagcccaccgggggcgtacttctccatgccggtgctcctgaccctcctttgggctctgcttaaagctggcatggtgtcccatgtcttctcagtccttcacgtcagcttggcccataaattagtgcctgaccacgagttcctgctggctctttttaactatgtgagagacaaggggctccagagcttgataccagaactgatggagctcaccttcaagatggccggcgttggtttggagctggacttggactggatggaaaatgtgaaaaacactcccatgtttcagcagacggctcagcagacgtcacacgatgctttggttggcaaccacaatcctgagctgctgaatttattgcatgggattgttgaaatagagctttgtgtcaagcaagaagactggaaacggatgggagaggtgtataaggccctctgccagttcagccagcaccctaaccaagtggagcgcatcagcggccgcgtcgccgtagcccttctgtctgagagcaaagacaaggtgtcactgccctttgctgcttttgctgagacagcgtgtcagggtgaaagtggggagaaccttgttaagagttttttgggcagaatcggagtcactttgatgttaagataccacaaaaaccagcattggactaagggctgcagagtggtggaggtgatgtctgttttaaaagtggactacaccgtactgaagagtttatttggaaatgaacatggagtatcacgctgctacattatcagtgtggcagcagagctcttcttcctgagtggaagtgtggaaggagctctgaagacacttcgagaacacaactggttcctgagttcgagttcgtggccatgtgagcctgctgatctggagaggaggactaatgtgttgaggcgtctggctggtaaaacctcctaccgggacacgctggaggtgctctgcaatctgccaggagttaaggaacccaacgacttgatagacatctccaggtacagtcctctgtttgcgtctcacctccaagtgtgcgtggagaggcaggttctacctgtggcgtcggacacgctggacttcatgctgtgtaaaaagctggctgttgagcacccactgctccaggcggtgctcgacaaactggggaaacagaacctgtggctgcgggcgcgggaactcttcaaacattcgttgaatgtgggctactaccctggagtgtctgcagcccccggttcgatggcgctgattgtaccatgtcagcttggagaggtggagcttgccatcaccttggagatgttcgttgccttaaatgcgtcggccattcttcctctttcagacaccgccaccggtcctcctctcagcatcactctaagaaggactctcagctgtgaggtggagtacatctcagcaggtaaccgccttctttccgcagcttgccttcctcagcccaaactcactgtccactacatcgaggtcaactcctcccaggagcaggtgtttaggctccacgttcccaccgcacaccgctggctccgccacaaccactcatgggccagcgagatgtggacacagcaagctaaatgtttaaaccctaactgatcttggcaagtatttgacattgtttatgttcagcatcagtgagttctccaggaaaggtcaatgaatcaggtagaaccacgtgtttcatctcaagttctatgggggcgggggggctaacggcagaaaattgcaaccttttttggctttcactcagttttaagggactatttgaatttatttattttgggaaacagtttatttttttgggggttggggggtgtaaggctgtttacctgtatataaaatttgaatgtaaatatgtatttatatgaccacattatgtttctgtattgtttgttacaatataaagtgttgcttgttcagagcttgcaatttaccatttctttgtatgaaatgttttattaaaagcttgcttctctgtgtgcgtgtacatatttatagacaacattctttacatgcaatattgaggaaaagtggat
//

by @meso_cacase at DBCLS
This page is licensed under a Creative Commons Attribution 4.0 International License (CC BY 4.0).

If you use GGRNA in your work, please cite:
Naito Y, Bono H. (2012)
GGRNA: an ultrafast, transcript-oriented search engine for genes and transcripts.
Nucleic Acids Res., 40, W592-W596. [Full Text]