GGRNA ver.2 Home | Help | Advanced search    Previous release (v1)

2025-10-16 09:57:10, GGRNA.v2 : RefSeq release 232 (Sep, 2025)

LOCUS       XM_022954129            2488 bp    mRNA    linear   INV 25-OCT-2017
DEFINITION  PREDICTED: Stylophora pistillata protein argonaute-2-like
            (LOC111346866), mRNA.
ACCESSION   XM_022954129
VERSION     XM_022954129.1
DBLINK      BioProject: PRJNA415215
KEYWORDS    RefSeq.
SOURCE      Stylophora pistillata
  ORGANISM  Stylophora pistillata
            Eukaryota; Metazoa; Cnidaria; Anthozoa; Hexacorallia; Scleractinia;
            Astrocoeniina; Pocilloporidae; Stylophora.
COMMENT     MODEL REFSEQ:  This record is predicted by automated computational
            analysis. This record is derived from a genomic sequence
            (NW_019218982.1) annotated using gene prediction method: Gnomon.
            Also see:
                Documentation of NCBI's Annotation Process
            
            ##Genome-Annotation-Data-START##
            Annotation Provider         :: NCBI
            Annotation Status           :: Full annotation
            Annotation Version          :: Stylophora pistillata Annotation
                                           Release 100
            Annotation Pipeline         :: NCBI eukaryotic genome annotation
                                           pipeline
            Annotation Software Version :: 7.4
            Annotation Method           :: Best-placed RefSeq; Gnomon
            Features Annotated          :: Gene; mRNA; CDS; ncRNA
            ##Genome-Annotation-Data-END##
FEATURES             Location/Qualifiers
     source          1..2488
                     /organism="Stylophora pistillata"
                     /mol_type="mRNA"
                     /isolate="CSM Monaco"
                     /isolation_source="northern Red Sea"
                     /db_xref="taxon:50429"
                     /chromosome="Unknown"
                     /tissue_type="whole animal"
                     /geo_loc_name="Jordan: Aqaba"
                     /collection_date="01-Jan-1995"
                     /note="holotype #3, clade 4"
     gene            1..2488
                     /gene="LOC111346866"
                     /note="Derived by automated computational analysis using
                     gene prediction method: Gnomon. Supporting evidence
                     includes similarity to: 20 Proteins, and 94% coverage of
                     the annotated genomic feature by RNAseq alignments"
                     /db_xref="GeneID:111346866"
     CDS             32..2419
                     /gene="LOC111346866"
                     /codon_start=1
                     /product="protein argonaute-2-like"
                     /protein_id="XP_022809864.1"
                     /db_xref="GeneID:111346866"
                     /translation="
MQPPKRPDYGTKGRLIALRANFLCLNTSPELSDLYHYDVEITPDKCPKEIKRDIVNEAIKKYKNTVFQGHHPAFDGERNLYSRIELPVRVKLNVQLPGGDGGRDRHLEVRIQFAGSVSLLELNNFLSGKQDVKRPHGTVQALNTVVRQMPSLSNTSVGKLLFPIGGQGRFLGEGCERKFGFTLSVRPSGWKAMLVNIDVSAKGFYKELAVVPDFLYDTLGLKLNNLKDCKYEVDRGKLEKVICGLRIQTTHAASIKRKYRVWGVSAKSAERMQFDVTDEGTGRTYKTTVAEYFKDRHKVTLRYPHLPCLRVGQKKGTYLPLEVCTVIPCERKHLSEQQITNMIRSTARPAPEQQRDIQHWAQEMTRESNEYLRNEFQTSLNSEMVKVEGHVLPAPRINLGPQDLPLVPRDGSWDMRNKSLHDGARIDQWALACFDRGCREEQLRNFSGQMANVSSRQGLRMSEQPVVVAYGRGIRDVESLFSKWVVDFPGLQLIMAVLPERDKQIYPELKRVGDNVIGIPTQGVQSKNVYSCKPHLCANLALKINSKLGGINHVIAAVVASMDANATKYYARVRAQNHRNGKAAQEIINDLAAMVRELLIEFYKANRKLKPSKIIFYRDGVSEGKFDQVLVHEVRAVQQACMDLEKAYRPRITFVVVQKRHHTRLYCENQRDEVGKARNVPPGTTVDSGITHPYEFDFYLCSHNGIQGTSRPKHYHVLYDDNSFTADALQQLTYQLCHLYARSTRSVSMPAPAYFAHLVAFRARHHVTGNGSVDLENTTKAIEVNAKMKGAMYFT"
     misc_feature    239..469
                     /gene="LOC111346866"
                     /note="N-terminal domain of argonaute; Region: ArgoN;
                     pfam16486"
                     /db_xref="CDD:465134"
     misc_feature    497..649
                     /gene="LOC111346866"
                     /note="Argonaute linker 1 domain; Region: ArgoL1;
                     pfam08699"
                     /db_xref="CDD:462567"
     misc_feature    <731..1012
                     /gene="LOC111346866"
                     /note="PAZ domain, argonaute_like subfamily. Argonaute is
                     part of the RNA-induced silencing complex (RISC), and is
                     an endonuclease that plays a key role in the RNA
                     interference pathway. The PAZ domain has been named after
                     the proteins Piwi,Argonaut, and Zwille; Region:
                     PAZ_argonaute_like; cd02846"
                     /db_xref="CDD:239212"
     misc_feature    order(806..808,851..853,896..898,908..910,962..964,
                     980..982,986..988)
                     /gene="LOC111346866"
                     /note="nucleic acid-binding interface [nucleotide
                     binding]; other site"
                     /db_xref="CDD:239212"
     misc_feature    1151..2329
                     /gene="LOC111346866"
                     /note="PIWI domain, Argonaute-like subfamily. Argonaute is
                     the central component of the RNA-induced silencing complex
                     (RISC) and related complexes. The PIWI domain is the
                     C-terminal portion of Argonaute and consists of two
                     subdomains, one of which provides the...; Region:
                     Piwi_ago-like; cd04657"
                     /db_xref="CDD:240015"
     misc_feature    order(1547..1549,1559..1561,1595..1606,1613..1615,
                     1637..1639,1646..1648,1658..1660,1670..1672)
                     /gene="LOC111346866"
                     /note="5' RNA guide strand anchoring site [active]"
                     /db_xref="CDD:240015"
ORIGIN      
cactactggtcagattctaagaaacagtggaatgcaacctccaaaaagaccagattatggcacaaaaggccgccttatagctttgagggcaaacttcctctgcctaaatacatcaccggagctttcagacctgtatcactatgatgttgaaataactccagacaaatgtcccaaagaaataaagagggacattgttaatgaagccataaagaaatacaaaaatacagtatttcaaggccaccatcctgcttttgatggtgaaaggaacttgtacagtaggatagaactgcctgttcgtgttaaacttaacgttcaactacctggaggggatggaggtagagacagacatttggaggtcagaattcagtttgctggttcagtgagtcttttggaacttaacaactttttgagtggaaaacaagatgtcaaaagacctcatggtacagtacaggccctaaacactgtggtgcgtcagatgccgtcattgtctaacacctctgttggaaaattattatttccaattggtggtcaaggaagattcctgggagaggggtgtgagcggaaatttggttttactttaagtgttcggccttctggttggaaggccatgctggtgaacattgatgtctctgcaaagggattttacaaggagcttgctgttgttcctgacttcttgtatgacaccctcgggttaaaactgaataacctcaaagactgcaaatatgaagtggatagaggaaagcttgaaaaagttatatgtggacttcgtattcaaactactcatgctgcctctattaagaggaagtacagagtttggggcgtgtcagcaaaatcggccgaaaggatgcagtttgatgttacagatgagggaacaggtcgcacatacaaaacaactgtcgcagagtatttcaaggacagacacaaggtgacattgaggtatcctcatctgccgtgcttacgagttggacagaaaaagggcacgtatctgccactggaggtctgtaccgttattccttgtgaaaggaaacatttatctgaacaacagattacgaacatgatcagaagtactgctcgccctgcacctgagcaacagcgtgacattcaacactgggcccaagaaatgactcgagaaagtaacgagtatctaagaaatgagttccaaacctcactcaactcagagatggttaaggtagaaggacatgtgcttccagcacccagaatcaaccttggaccccaggatctgccattggttcctcgtgatggctcatgggatatgcgcaacaaatcactgcatgatggagcccgtattgatcagtgggcattggcttgttttgacaggggatgtcgggaagaacagctgagaaatttttctgggcaaatggcgaatgtatccagtcgacagggtttgagaatgtcagagcagccagttgttgtggcatacggcaggggcataagagatgttgagagtttgttttctaagtgggtagtagattttccaggcttacaacttatcatggctgttctgccagagagagacaaacaaatctatccagagttaaaacgtgttggcgacaatgttatcggaattccaacgcagggtgtacagtcaaaaaatgtatacagttgtaaacctcacctttgcgccaatctcgcgttgaagatcaactccaaacttggaggaatcaaccatgtaattgctgctgttgtggcaagtatggatgccaatgccacaaagtactatgcacgagtgcgagcacagaaccacagaaatggaaaagcagctcaagaaataattaatgacttggcggctatggtgagagagcttcttattgagttttacaaagccaatcggaagcttaagcctagcaagatcatcttctaccgagatggagtcagcgagggtaaatttgaccaagtacttgttcatgaagtgcgagccgtgcaacaggcctgtatggatcttgaaaaagcttatcgcccaagaatcacctttgtggtggttcagaagcgccatcatacgagattgtactgtgaaaaccaacgagatgaagttggaaaagcaagaaatgttcctcctggtacaactgtggacagcggtatcacgcatccttacgagttcgacttttatctgtgcagccataatggaatccagggaacaagccgacccaagcactaccatgtgttatatgacgataactcattcacagcggacgcccttcagcagctcacgtaccagctgtgtcacttgtacgcaaggagcacgcgtagcgtctccatgccagcccccgcctattttgcccacttggtggcctttagagctagacaccacgtgaccggaaatggaagtgttgacctggagaacactacaaaagccatcgaagtcaacgctaagatgaaaggagccatgtactttacttaaaatattaataaaatattaataaaatatcacgtatcgtgatattttattaatattttattaatgtattat
//

by @meso_cacase at DBCLS
This page is licensed under a Creative Commons Attribution 4.0 International License (CC BY 4.0).

If you use GGRNA in your work, please cite:
Naito Y, Bono H. (2012)
GGRNA: an ultrafast, transcript-oriented search engine for genes and transcripts.
Nucleic Acids Res., 40, W592-W596. [Full Text]