2025-09-16 20:29:38, GGRNA.v2 : RefSeq release 231 (Jul, 2025)
LOCUS XM_021916304 543 bp mRNA linear PLN 20-JUL-2017 DEFINITION PREDICTED: Chenopodium quinoa G-type lectin S-receptor-like serine/threonine-protein kinase RLK1 (LOC110736155), mRNA. ACCESSION XM_021916304 VERSION XM_021916304.1 DBLINK BioProject: PRJNA394242 KEYWORDS RefSeq. SOURCE Chenopodium quinoa (quinoa) ORGANISM Chenopodium quinoa Eukaryota; Viridiplantae; Streptophyta; Embryophyta; Tracheophyta; Spermatophyta; Magnoliopsida; eudicotyledons; Gunneridae; Pentapetalae; Caryophyllales; Chenopodiaceae; Chenopodioideae; Atripliceae; Chenopodium. COMMENT MODEL REFSEQ: This record is predicted by automated computational analysis. This record is derived from a genomic sequence (NW_018743292.1) annotated using gene prediction method: Gnomon. Also see: Documentation of NCBI's Annotation Process ##Genome-Annotation-Data-START## Annotation Provider :: NCBI Annotation Status :: Full annotation Annotation Version :: Chenopodium quinoa Annotation Release 100 Annotation Pipeline :: NCBI eukaryotic genome annotation pipeline Annotation Software Version :: 7.4 Annotation Method :: Best-placed RefSeq; Gnomon Features Annotated :: Gene; mRNA; CDS; ncRNA ##Genome-Annotation-Data-END## FEATURES Location/Qualifiers source 1..543 /organism="Chenopodium quinoa" /mol_type="mRNA" /cultivar="QQ74" /db_xref="taxon:63459" /chromosome="Unknown" /tissue_type="leaves" /dev_stage="flowering" /geo_loc_name="Saudi Arabia" gene 1..543 /gene="LOC110736155" /note="Derived by automated computational analysis using gene prediction method: Gnomon. Supporting evidence includes similarity to: 100% coverage of the annotated genomic feature by RNAseq alignments" /db_xref="GeneID:110736155" CDS 1..531 /gene="LOC110736155" /codon_start=1 /product="G-type lectin S-receptor-like serine/threonine-protein kinase RLK1" /protein_id="XP_021771996.1" /db_xref="GeneID:110736155" /translation="
MAAWPLPSTLSLLTLILLQSSPIAAQNKGNIPVGQSLSAATNNSSWHSPSGDFAFGFSKFSNSSNLFLLAIWYVKIPTTIVWYANDGNPVPQGSSVKITANEGLVLSDPNGIDLWNTSDTLSDGGEVKYGYLNDTGNFALKSSSSDNPVWQSFNHPTDTLLPSQVMEINMEVNSKL"
misc_feature 121..468 /gene="LOC110736155" /note="Bulb-type mannose-specific lectin. The domain contains a three-fold internal repeat (beta-prism architecture). The consensus sequence motif QXDXNXVXY is involved in alpha-D-mannose recognition. Lectins are carbohydrate-binding proteins which specifically...; Region: B_lectin; cd00028" /db_xref="CDD:237995" misc_feature order(121..123,130..132,214..216,241..246,343..345, 349..351,373..375,379..381,391..393,397..423,427..468) /gene="LOC110736155" /note="dimerization interface [polypeptide binding]; other site" /db_xref="CDD:237995" misc_feature order(187..189,196..198,202..204,211..213,217..219, 295..297,301..303,307..309,313..315,319..321,397..399, 403..405,409..411,415..417,421..423) /gene="LOC110736155" /note="mannose binding site [chemical binding]; other site" /db_xref="CDD:237995" ORIGIN
atggcggcttggcctcttcctagcaccctctccttgttaacactaatactcctacaatcatcacctattgctgcccaaaataaaggcaatataccagtaggacaatccctatcagctgccaccaataattcttcatggcattccccttcgggcgatttcgcctttggcttttccaaattttcaaacagcagcaatctcttcttgcttgccatctggtatgtcaagattcccaccaccattgtttggtacgcaaatgatggtaatcctgttcctcaaggatcatcagtcaagattacagctaatgagggactagttctcagtgatcctaacggaattgacctatggaacacctctgatacgctaagtgatggaggtgaggtaaagtatggctacctgaatgatactgggaatttcgccctcaaaagtagcagcagtgacaatccagtttggcagagctttaaccatcctacagacaccttgctgccttctcaggttatggagataaatatggaggttaactctaagctataaagaactaatttc
//
by
@meso_cacase at
DBCLS
This page is licensed under a
Creative Commons Attribution 4.0 International License (CC BY 4.0).
If you use GGRNA in your work, please cite:
Naito Y, Bono H. (2012)
GGRNA: an ultrafast, transcript-oriented search engine for genes and transcripts.
Nucleic Acids Res., 40, W592-W596.
[Full Text]