2024-06-18 15:34:22, GGRNA.v2 : RefSeq release 224 (May, 2024)
LOCUS NM_001271454 2012 bp mRNA linear ROD 30-MAR-2024 DEFINITION Rattus norvegicus immunoglobin superfamily, member 21 (Igsf21), mRNA. ACCESSION NM_001271454 XM_003754110 VERSION NM_001271454.2 KEYWORDS RefSeq; RefSeq Select. SOURCE Rattus norvegicus (Norway rat) ORGANISM Rattus norvegicus Eukaryota; Metazoa; Chordata; Craniata; Vertebrata; Euteleostomi; Mammalia; Eutheria; Euarchontoglires; Glires; Rodentia; Myomorpha; Muroidea; Muridae; Murinae; Rattus. REFERENCE 1 (bases 1 to 2012) AUTHORS Tanabe,Y., Naito,Y., Vasuta,C., Lee,A.K., Soumounou,Y., Linhoff,M.W. and Takahashi,H. TITLE IgSF21 promotes differentiation of inhibitory synapses via binding to neurexin2alpha JOURNAL Nat Commun 8 (1), 408 (2017) PUBMED 28864826 REMARK Publication Status: Online-Only COMMENT VALIDATED REFSEQ: This record has undergone validation or preliminary review. The reference sequence was derived from JAXUCZ010000005.1. On Feb 11, 2021 this sequence version replaced NM_001271454.1. Sequence Note: The RefSeq transcript and protein were derived from genomic sequence to make the sequence consistent with the reference genome assembly. The genomic coordinates used for the transcript record were based on alignments. ##Evidence-Data-START## Transcript exon combination :: SRR22399481.2250465.1, SRR22399481.805834.1 [ECO:0000332] RNAseq introns :: mixed sample support SAMEA5760383, SAMEA5760389 [ECO:0006172] ##Evidence-Data-END## ##RefSeq-Attributes-START## RefSeq Select criteria :: based on conservation, expression, longest protein ##RefSeq-Attributes-END## PRIMARY REFSEQ_SPAN PRIMARY_IDENTIFIER PRIMARY_SPAN COMP 1-522 JAXUCZ010000005.1 157794769-157795290 c 523-635 JAXUCZ010000005.1 157702997-157703109 c 636-757 JAXUCZ010000005.1 157651424-157651545 c 758-876 JAXUCZ010000005.1 157611087-157611205 c 877-992 JAXUCZ010000005.1 157581618-157581733 c 993-1467 JAXUCZ010000005.1 157578614-157579088 c 1468-1553 JAXUCZ010000005.1 157572873-157572958 c 1554-1746 JAXUCZ010000005.1 157572212-157572404 c 1747-1785 JAXUCZ010000005.1 157571846-157571884 c 1786-2012 JAXUCZ010000005.1 157570964-157571190 c FEATURES Location/Qualifiers source 1..2012 /organism="Rattus norvegicus" /mol_type="mRNA" /strain="BN" /db_xref="taxon:10116" /chromosome="5" /map="5q36" gene 1..2012 /gene="Igsf21" /gene_synonym="RGD1310117" /note="immunoglobin superfamily, member 21" /db_xref="GeneID:298591" /db_xref="RGD:1310117" exon 1..522 /gene="Igsf21" /gene_synonym="RGD1310117" /inference="alignment:Splign:2.1.0" misc_feature 354..356 /gene="Igsf21" /gene_synonym="RGD1310117" /note="upstream in-frame stop codon" CDS 453..1859 /gene="Igsf21" /gene_synonym="RGD1310117" /note="immunoglobulin superfamily member 21" /codon_start=1 /product="immunoglobulin superfamily member 21 precursor" /protein_id="NP_001258383.1" /db_xref="GeneID:298591" /db_xref="RGD:1310117" /translation="
MRAAPSLRRASCLLLAAILDLARGYLTVNIEPLPPVVAGDAVTLKCNFKTDGRMREIVWYRVTDGGTIKQKIFTFDAMFSTNYSHMENYRKREDLVYQSTVRLPEVRISDNGPYECHVGIYDRATREKVVLASGNIFLNVMAPPTSIEVVAADSPAPFSRYQAQNFTLVCIVSGGKPAPMVYFKRDGEPIDAVPLTELPASSSGSVQDSRPFRSLLHRDVDDTKMQKSLSLLDTEYRAGRPYTERPSRSLTQDPNLFVQPTTENIPETVVSREFPRWVHSAEPVYFLRHSRTPGSDGTVEVRALLTWTLNPQIDNEALFSCEVKHPALSMPMQAEVTLVAPKGPKIMMTPSRARVGDTVRILVHGFQNEVFPEPMFTWTRVGSRLLDGSAEFDGKELVLERVPAELNGSMYRCTAQNPLGSTDTHTRLIVFENPNIPRGTEDSRGSASGPTGVRLTLVLALTVILELT"
sig_peptide 453..524 /gene="Igsf21" /gene_synonym="RGD1310117" /inference="COORDINATES: ab initio prediction:SignalP:6.0" mat_peptide 525..1856 /gene="Igsf21" /gene_synonym="RGD1310117" /product="Immunoglobulin superfamily member 21. /id=PRO_0000444205" /note="propagated from UniProtKB/Swiss-Prot (M0RAS4.3)" misc_feature 540..842 /gene="Igsf21" /gene_synonym="RGD1310117" /note="Immunoglobulin domain; Region: Ig; cl11960" /db_xref="CDD:472250" misc_feature 576..590 /gene="Igsf21" /gene_synonym="RGD1310117" /note="Ig strand B [structural motif]; Region: Ig strand B" /db_xref="CDD:409353" misc_feature 618..632 /gene="Igsf21" /gene_synonym="RGD1310117" /note="Ig strand C [structural motif]; Region: Ig strand C" /db_xref="CDD:409353" misc_feature 750..761 /gene="Igsf21" /gene_synonym="RGD1310117" /note="Ig strand E [structural motif]; Region: Ig strand E" /db_xref="CDD:409353" misc_feature 789..806 /gene="Igsf21" /gene_synonym="RGD1310117" /note="Ig strand F [structural motif]; Region: Ig strand F" /db_xref="CDD:409353" misc_feature 819..830 /gene="Igsf21" /gene_synonym="RGD1310117" /note="Ig strand G [structural motif]; Region: Ig strand G" /db_xref="CDD:409353" misc_feature <1566..1748 /gene="Igsf21" /gene_synonym="RGD1310117" /note="Immunoglobulin domain; Region: Ig; cl11960" /db_xref="CDD:472250" misc_feature 1575..1589 /gene="Igsf21" /gene_synonym="RGD1310117" /note="Ig strand C [structural motif]; Region: Ig strand C" /db_xref="CDD:409353" misc_feature 1635..1649 /gene="Igsf21" /gene_synonym="RGD1310117" /note="Ig strand E [structural motif]; Region: Ig strand E" /db_xref="CDD:409353" misc_feature 1677..1697 /gene="Igsf21" /gene_synonym="RGD1310117" /note="Ig strand F [structural motif]; Region: Ig strand F" /db_xref="CDD:409353" misc_feature 1722..1733 /gene="Igsf21" /gene_synonym="RGD1310117" /note="Ig strand G [structural motif]; Region: Ig strand G" /db_xref="CDD:409353" exon 523..635 /gene="Igsf21" /gene_synonym="RGD1310117" /inference="alignment:Splign:2.1.0" exon 636..757 /gene="Igsf21" /gene_synonym="RGD1310117" /inference="alignment:Splign:2.1.0" exon 758..876 /gene="Igsf21" /gene_synonym="RGD1310117" /inference="alignment:Splign:2.1.0" exon 877..992 /gene="Igsf21" /gene_synonym="RGD1310117" /inference="alignment:Splign:2.1.0" exon 993..1467 /gene="Igsf21" /gene_synonym="RGD1310117" /inference="alignment:Splign:2.1.0" exon 1468..1553 /gene="Igsf21" /gene_synonym="RGD1310117" /inference="alignment:Splign:2.1.0" exon 1554..1746 /gene="Igsf21" /gene_synonym="RGD1310117" /inference="alignment:Splign:2.1.0" exon 1747..1785 /gene="Igsf21" /gene_synonym="RGD1310117" /inference="alignment:Splign:2.1.0" exon 1786..2012 /gene="Igsf21" /gene_synonym="RGD1310117" /inference="alignment:Splign:2.1.0" ORIGIN
gagcgcggggcagagcgcggcggcgcgggcagagcttcggctccaaactccgccgctgccgccacggatccgactccggccgccgtgggcgccaggagcagccgaccagccgagagcagctgcgctccccagccaggtcctgtgcagcccagagcagccagtgtgtctggtgcagcccggagcatcctagtacagctcagagtagcctggtggtgtatcccggagcatcccggtacagcccagagcagccccgggtagcctggcggcccgaccacggtagcatgaggacgtccccgcggcgcccctcgctgcccgtcaccgccacggccggcggcccgggtcataagcgcttctgagcccatggcgaggggacccaccgtcgccaccgcgatcgccgccgccgccgccgccgccgccgccgcctcggccagcgccgtcagctcctgggcaccatgcgagctgctccaagcctccgccgcgcctcctgcctgctgctcgccgcgatcctggacctggcgcgcggctacctgacagtgaacattgagccccttccccctgtggtggccggggatgcagtgaccctgaagtgcaacttcaagacagacggccgcatgcgtgagatcgtgtggtaccgggtgacagatggcggcaccatcaagcagaagatcttcaccttcgatgccatgttctccaccaactactcccacatggagaattaccgcaagagggaggatcttgtgtaccagtccactgtgaggctgcctgaggtccggatctcagacaatggtccctatgagtgccacgtggggatctacgaccgagccacgagggagaaggtggtcctcgcctcgggcaacatcttcctcaacgtcatggctcctcccacctccattgaagtcgtggctgccgactcccctgcccccttcagccggtaccaggcccagaacttcacactggtctgcatcgtgtcaggagggaagccagcacccatggtttatttcaaacgggatggggaaccgattgatgccgtgcccctgacagaactgccagcgtccagctctggctcggtccaggacagcaggcccttccgcagccttctgcatagagacgtggacgataccaaaatgcaaaagtcactatcccttctggacactgaataccgggctggacgtccctacacggagcgcccctcgcgcagcctgacccaggaccccaacctcttcgtgcagcccaccacggaaaacataccagagacagtggtgagccgagagttcccccgttgggtacacagtgccgagccggtctacttcctgcgccacagccgcaccccaggcagcgatggcacggtggaggtgcgggccctgctcacctggaccctcaacccgcagatcgacaatgaggccctcttcagctgtgaggtcaagcacccagcgctgtctatgcccatgcaggcggaggtcacgctggttgctcccaaaggacccaaaatcatgatgacgcccagcagagcccgggttggggatacagtgaggatcctagtccacggatttcagaatgaggtcttcccagaacccatgttcacgtggacgagagtgggcagccgcctcctggatgggagtgctgaatttgacgggaaggagcttgtactggagcgggtccctgctgagctcaacggctccatgtaccgctgcactgcccagaacccactgggctccactgatacacacactcggctcatcgtgttcgaaaacccaaatatcccaagaggaaccgaggactcccgtggttctgcttctggccccactggcgtccggctcaccctggtgcttgccctgacagtgatcctggagctgacgtgaagatgccgccccctcccgatgctccagcggcccggcatctctgcgatcgattttcatgtcttttctaaactatttccagtcttgttcttagtcttggcccatgtcttggcttcctcactgggtttaattaaacagacagaccgattttcccca
//
by
@meso_cacase at
DBCLS
This page is licensed under a
Creative Commons Attribution 4.0 International License (CC BY 4.0).
If you use GGRNA in your work, please cite:
Naito Y, Bono H. (2012)
GGRNA: an ultrafast, transcript-oriented search engine for genes and transcripts.
Nucleic Acids Res., 40, W592-W596.
[Full Text]