2024-05-19 00:37:43, GGRNA.v2 : RefSeq release 222 (Jan, 2024)
LOCUS NM_176857 3864 bp mRNA linear ROD 20-MAR-2023 DEFINITION Rattus norvegicus valosin containing protein interacting protein 1 (Vcpip1), mRNA. ACCESSION NM_176857 VERSION NM_176857.3 KEYWORDS RefSeq; RefSeq Select. SOURCE Rattus norvegicus (Norway rat) ORGANISM Rattus norvegicus Eukaryota; Metazoa; Chordata; Craniata; Vertebrata; Euteleostomi; Mammalia; Eutheria; Euarchontoglires; Glires; Rodentia; Myomorpha; Muroidea; Muridae; Murinae; Rattus. REFERENCE 1 (bases 1 to 3864) AUTHORS Mevissen TE, Hospenthal MK, Geurink PP, Elliott PR, Akutsu M, Arnaudo N, Ekkebus R, Kulathu Y, Wauer T, El Oualid F, Freund SM, Ovaa H and Komander D. TITLE OTU deubiquitinases reveal mechanisms of linkage specificity and enable ubiquitin chain restriction analysis JOURNAL Cell 154 (1), 169-184 (2013) PUBMED 23827681 REFERENCE 2 (bases 1 to 3864) AUTHORS Totsukawa G, Kaneko Y, Uchiyama K, Toh H, Tamura K and Kondo H. TITLE VCIP135 deubiquitinase and its binding protein, WAC, in p97ATPase-mediated membrane fusion JOURNAL EMBO J 30 (17), 3581-3593 (2011) PUBMED 21811234 REMARK GeneRIF: WAC is hence thought to function in p97/p47-mediated Golgi membrane fusion by activating the deubiquitinating function of VCIP135. Publication Status: Online-Only REFERENCE 3 (bases 1 to 3864) AUTHORS Arakawa T, Katada A, Shigyo H, Kishibe K, Adachi M, Nonaka S and Harabuchi Y. TITLE Electrical stimulation prevents apoptosis in denervated skeletal muscle JOURNAL NeuroRehabilitation 27 (2), 147-154 (2010) PUBMED 20871144 REMARK GeneRIF: Electrical stimulation increased valosin-containing protein (VCP) expression and decreased cleaved caspase-12 expression in denervated muscles. REFERENCE 4 (bases 1 to 3864) AUTHORS Faouzi S, Medzihradszky KF, Hefner C, Maher JJ and Correia MA. TITLE Characterization of the physiological turnover of native and inactivated cytochromes P450 3A in cultured rat hepatocytes: a role for the cytosolic AAA ATPase p97? JOURNAL Biochemistry 46 (26), 7793-7803 (2007) PUBMED 17550236 REMARK GeneRIF: findings clearly reveal that native CYPs 3A undergo UPD and implicate a role for p97 in this process. REFERENCE 5 (bases 1 to 3864) AUTHORS Trinidad JC, Specht CG, Thalhammer A, Schoepfer R and Burlingame AL. TITLE Comprehensive identification of phosphorylation sites in postsynaptic density preparations JOURNAL Mol Cell Proteomics 5 (5), 914-922 (2006) PUBMED 16452087 REFERENCE 6 (bases 1 to 3864) AUTHORS Yamamoto S, Tomita Y, Hoshida Y, Iizuka N, Kidogami S, Miyata H, Takiguchi S, Fujiwara Y, Yasuda T, Yano M, Nakamori S, Sakon M, Monden M and Aozasa K. TITLE Expression level of valosin-containing protein (p97) is associated with prognosis of esophageal carcinoma JOURNAL Clin Cancer Res 10 (16), 5558-5565 (2004) PUBMED 15328197 REMARK GeneRIF: Expression is ignificant in the prognosis of esophageal squamous cell carcinoma REFERENCE 7 (bases 1 to 3864) AUTHORS Wang Y, Satoh A, Warren G and Meyer HH. TITLE VCIP135 acts as a deubiquitinating enzyme during p97-p47-mediated reassembly of mitotic Golgi fragments JOURNAL J Cell Biol 164 (7), 973-978 (2004) PUBMED 15037600 REMARK GeneRIF: p97-p47-mediated reassembly of Golgi cisternae requires ubiquitin, but is not dependent on proteasome-mediated proteolysis. Erratum:[J Cell Biol. 2004 Aug 2;166(3):433. Wang, Yangzhuang [corrected to Wang, Yanzhuang]] REFERENCE 8 (bases 1 to 3864) AUTHORS Uchiyama K, Jokitalo E, Lindman M, Jackman M, Kano F, Murata M, Zhang X and Kondo H. TITLE The localization and phosphorylation of p47 are important for Golgi disassembly-assembly during the cell cycle JOURNAL J Cell Biol 161 (6), 1067-1079 (2003) PUBMED 12810701 REMARK GeneRIF: P47 localizes to the nucleus during interphase and is phosphorylated on Serine-140 by Cdc2 at mitosis. Phosphorylated p47 does not bind to Golgi membranes. REFERENCE 9 (bases 1 to 3864) AUTHORS Uchiyama K, Jokitalo E, Kano F, Murata M, Zhang X, Canas B, Newman R, Rabouille C, Pappin D, Freemont P and Kondo H. TITLE VCIP135, a novel essential factor for p97/p47-mediated membrane fusion, is required for Golgi and ER assembly in vivo JOURNAL J Cell Biol 159 (5), 855-866 (2002) PUBMED 12473691 REMARK GeneRIF: VCIP135 is required for golgi and endoplasmic reticulum assembly. COMMENT PROVISIONAL REFSEQ: This record has not yet been subject to final NCBI review. The reference sequence was derived from AB045378.2. On Jun 10, 2007 this sequence version replaced NM_176857.2. ##Evidence-Data-START## Transcript exon combination :: AB045378.2, AF289091.1 [ECO:0000332] RNAseq introns :: single sample supports all introns SAMD00132261, SAMD00132263 [ECO:0000348] ##Evidence-Data-END## ##RefSeq-Attributes-START## RefSeq Select criteria :: based on single protein-coding transcript ##RefSeq-Attributes-END## FEATURES Location/Qualifiers source 1..3864 /organism="Rattus norvegicus" /mol_type="mRNA" /db_xref="taxon:10116" /chromosome="5" /map="5q11" gene 1..3864 /gene="Vcpip1" /gene_synonym="Vcip135" /note="valosin containing protein interacting protein 1" /db_xref="GeneID:286761" /db_xref="RGD:708520" exon 1..2824 /gene="Vcpip1" /gene_synonym="Vcip135" /inference="alignment:Splign:2.1.0" misc_feature 40..42 /gene="Vcpip1" /gene_synonym="Vcip135" /note="upstream in-frame stop codon" CDS 118..3783 /gene="Vcpip1" /gene_synonym="Vcip135" /EC_number="3.4.19.12" /note="deubiquitinating protein VCIP135; valosin-containing protein p97/p47 complex-interacting protein 1; valosin-containing protein p97/p47 complex-interacting protein p135; VCP(p97)/p47-interacting protein; valosin-containing protein (p97)/p47 complex-interacting protein 135; VCP/p47 complex-interacting 135-kDa protein" /codon_start=1 /product="deubiquitinating protein VCPIP1" /protein_id="NP_789827.3" /db_xref="GeneID:286761" /db_xref="RGD:708520" /translation="
MSQPPPPPPLPPPPPPPEAPQTSSSLAAAATPGGLSKRRDRRILSGSCPDPKCQARLFFPASGSVSIECTECGQRHEQQQLLGVEEVTDPDVVLHNLLRNALLGVTGAPKKNTELVKVMGLSNYHCKLLSPILARYGMDKQTGRAKLLRDMNQGELFDCALLGDRAFLIEPEHVNTVGYGKDRSGSLLYLHDTLEDIKRANKSQECLIPVHVDGDGHCLVHAVSRALVGRELFWHALRENLKQHFQQHLARYQALFHDFIDAAEWEDIINECDPLFVPPEGVPLGLRNIHIFGLANVLHRPIILLDSLSGMRSSGDYSATFLPGLIPAEKCTGRDGHLNKPICIAWSSSGRNHYIPLVGIKGAALPKLPMNLLPKAWGVPQDLIKKYIKLEEDGGCVIGGDRSLQDKYLLRLVAAMEEVFMDKHGIHPSLVADVHQYFYRRTGVIGVQPEEVTAAAKKAVMDNRLHKCLLCGALSELHVPPEWLAPGGKLYNLAKSTHGQLRPDKNYSFPLNNLVCSYDPVKDVLLPDYGLSNLTACNWCHGTSVRRVRGDGSIVYLDGDRTNSRSTGGKCGCGFKHFWEGKEYDNLPEAFPITLEWGGRVVRETVYWFQYESDPSLNSNVYDVAMKLVTKHFPGEFGSEILVQKVVHTILHQTAKKNPDDYTPVNIDGAHAQRIGDVQGQELESQLPTKIILTGQKTKTLHKEELNMSKTERTIQQNITEQASVMQKRKTEKLKQEQKGQPRTVSPSTIRDGPSSAPATPTKAPYSPTTSKEKKIRITTNDGRQSMVTLKSSTTFFELQESIAREFNIPPYLQCIRYGFPPKELMPPQAGMEKEPVPLQHGDRITIEILKGKAEGGPSTAAHSAHTVRQEEIAVTGKLSSKELQEQADKEMYSLCLLATLMGEDVWSYAKGLPHMFQQGGVFYNIMKKTMGMADGKHCTFPHLPGKTFVYNASEDRLELCVDAAGHFPIGPDVEDLVKEAVSQVRAEATTRSRESSPSHGLLKLGSGGVVKKKSEQLHNVTAFQGKGHSLGTASSNPHMDPRARETLAVRKHNTGTDFSNSSIKTEPPVFTAASSNSELIRIAPGVVTMRDGRQIDPDVVEAQRKKLQEMVSSIQASMDKHLRDQSTEQTPSDLSQRKVEAVSSSVRPGNLQTGLPESFSLTGGTENLNTETTDSRVADVLGAAFATRSKAQKENSMEEPEEMDSQDAETTNTTEPMDHS"
misc_feature 118..237 /gene="Vcpip1" /gene_synonym="Vcip135" /note="propagated from UniProtKB/Swiss-Prot (Q8CF97.2); Region: Disordered. /evidence=ECO:0000256|SAM:MobiDB-lite" misc_feature 223..720 /gene="Vcpip1" /gene_synonym="Vcip135" /note="VCIP135 N-terminal; Region: VCIP135_N; pfam19437" /db_xref="CDD:437269" misc_feature 604..1194 /gene="Vcpip1" /gene_synonym="Vcip135" /note="OTU (ovarian tumor) domain of deubiquitinating protein VCIP135; Region: OTU_VCIP135; cd22769" /db_xref="CDD:438606" misc_feature order(730..735,907..909,928..930,970..978,1042..1044, 1171..1173,1177..1179) /gene="Vcpip1" /gene_synonym="Vcip135" /note="putative polypeptide substrate binding site [polypeptide binding]; other site" /db_xref="CDD:438606" misc_feature order(760..762,769..771,1174..1176) /gene="Vcpip1" /gene_synonym="Vcip135" /note="active site" /db_xref="CDD:438606" misc_feature 1336..1338 /gene="Vcpip1" /gene_synonym="Vcip135" /note="N6-acetyllysine. /evidence=ECO:0000250|UniProtKB:Q96JH7; propagated from UniProtKB/Swiss-Prot (Q8CF97.2); acetylation site" misc_feature 2287..2451 /gene="Vcpip1" /gene_synonym="Vcip135" /note="propagated from UniProtKB/Swiss-Prot (Q8CF97.2); Region: Disordered. /evidence=ECO:0000256|SAM:MobiDB-lite" misc_feature 2353..2355 /gene="Vcpip1" /gene_synonym="Vcip135" /note="Phosphoserine. /evidence=ECO:0007744|PubMed:22673903; propagated from UniProtKB/Swiss-Prot (Q8CF97.2); phosphorylation site" misc_feature 2383..2385 /gene="Vcpip1" /gene_synonym="Vcip135" /note="Phosphoserine. /evidence=ECO:0000250|UniProtKB:Q96JH7; propagated from UniProtKB/Swiss-Prot (Q8CF97.2); phosphorylation site" misc_feature 2401..2403 /gene="Vcpip1" /gene_synonym="Vcip135" /note="Phosphothreonine. /evidence=ECO:0000250|UniProtKB:Q96JH7; propagated from UniProtKB/Swiss-Prot (Q8CF97.2); phosphorylation site" misc_feature 2416..2418 /gene="Vcpip1" /gene_synonym="Vcip135" /note="Phosphoserine. /evidence=ECO:0000250|UniProtKB:Q96JH7; propagated from UniProtKB/Swiss-Prot (Q8CF97.2); phosphorylation site" misc_feature 2437..2661 /gene="Vcpip1" /gene_synonym="Vcip135" /note="ubiquitin-like (Ubl) domain found in ubiquitin thioesterase OTU1 and similar proteins; Region: Ubl_OTU1; cd17059" /db_xref="CDD:340579" misc_feature order(2446..2448,2473..2475,2566..2568,2575..2577, 2581..2583,2587..2589,2635..2649,2659..2661) /gene="Vcpip1" /gene_synonym="Vcip135" /note="VCP interaction site [polypeptide binding]; other site" /db_xref="CDD:340579" misc_feature 3079..3144 /gene="Vcpip1" /gene_synonym="Vcip135" /note="propagated from UniProtKB/Swiss-Prot (Q8CF97.2); Region: Disordered. /evidence=ECO:0000256|SAM:MobiDB-lite" misc_feature 3094..3096 /gene="Vcpip1" /gene_synonym="Vcip135" /note="Phosphoserine. /evidence=ECO:0000250|UniProtKB:Q96JH7; propagated from UniProtKB/Swiss-Prot (Q8CF97.2); phosphorylation site" misc_feature 3106..3108 /gene="Vcpip1" /gene_synonym="Vcip135" /note="Phosphoserine. /evidence=ECO:0000250|UniProtKB:Q96JH7; propagated from UniProtKB/Swiss-Prot (Q8CF97.2); phosphorylation site" misc_feature 3343..3345 /gene="Vcpip1" /gene_synonym="Vcip135" /note="Phosphoserine. /evidence=ECO:0000250|UniProtKB:Q96JH7; propagated from UniProtKB/Swiss-Prot (Q8CF97.2); phosphorylation site" misc_feature 3466..3648 /gene="Vcpip1" /gene_synonym="Vcip135" /note="propagated from UniProtKB/Swiss-Prot (Q8CF97.2); Region: Disordered. /evidence=ECO:0000256|SAM:MobiDB-lite" misc_feature 3682..3780 /gene="Vcpip1" /gene_synonym="Vcip135" /note="propagated from UniProtKB/Swiss-Prot (Q8CF97.2); Region: Disordered. /evidence=ECO:0000256|SAM:MobiDB-lite" misc_feature 3706..3708 /gene="Vcpip1" /gene_synonym="Vcip135" /note="Phosphoserine. /evidence=ECO:0007744|PubMed:22673903; propagated from UniProtKB/Swiss-Prot (Q8CF97.2); phosphorylation site" misc_feature 3733..3735 /gene="Vcpip1" /gene_synonym="Vcip135" /note="Phosphoserine. /evidence=ECO:0000250|UniProtKB:Q96JH7; propagated from UniProtKB/Swiss-Prot (Q8CF97.2); phosphorylation site" exon 2825..2911 /gene="Vcpip1" /gene_synonym="Vcip135" /inference="alignment:Splign:2.1.0" exon 2912..3864 /gene="Vcpip1" /gene_synonym="Vcip135" /inference="alignment:Splign:2.1.0" ORIGIN
ctggtagggaaaggaaagccattcgctctgggcctggactagacctcgtcgggccggcggaggtctggctatgtgcctttgagggtcgcttgggacgcagagcgagagccgagagcgatgtctcagccgccgccgcctcctccgctgccgccgccgccgcctccccccgaggctccgcagacttcgtcgtccctggcggcggcggctactccggggggcctttcgaaacgaagggaccggagaatcctttccgggagctgcccggatcccaagtgccaggcgcggctcttcttcccggcctcaggttctgtcagcatcgagtgtaccgagtgcggacagcggcacgagcagcaacagctgctgggagtggaggaggtgaccgacccggacgtagtgctgcacaatctgctgcggaacgcgctactcggggtgacgggggctcccaagaagaacacggaactggtaaaggtgatgggcctctccaactaccactgcaaattattgtcgcccatattggcacgctatggaatggacaaacaaacgggccgcgccaagcttctccgggacatgaaccaaggcgaactgttcgattgcgcgttactcggtgaccgggccttcctcatcgaaccagagcacgtcaacacagtgggctatggcaaggaccgatctggaagcctcctatatttgcatgacactctcgaggatatcaaacgggccaataaaagtcaagaatgccttattccagtgcatgtggatggggatggacactgcctagtgcatgctgtgtctagggctctagtaggccgagagctcttctggcatgccctgagggagaatctgaagcagcactttcagcagcacctagcccgatatcaagccctgtttcatgactttattgatgctgcagagtgggaggacattatcaatgaatgtgaccctctgtttgtgccacctgaaggtgtccccttaggcctgaggaatatccacatatttggccttgccaatgtgttacatcgtcccataattctcttagattccctcagtggcatgagaagctctggtgattattcagccacctttctacctgggctcatacctgcagagaagtgcactgggagagatggtcatttgaacaagccaatctgtattgcgtggagtagctctggtagaaaccattatattcccttggtaggcataaagggggctgccttgcccaaactacccatgaatttgctacctaaagcatggggtgtgcctcaggaccttattaaaaagtacatcaagcttgaggaggatggtggttgtgttattggaggagacagaagtttgcaggataagtacttacttaggttggttgctgctatggaggaagtctttatggacaaacatggtatccatcctagtttggttgctgatgtacatcagtatttctacagaaggactggggtgataggagttcagcctgaggaagttacagcagctgctaaaaaagcagtaatggataatcgccttcacaagtgtttgctttgtggtgccctttctgaacttcatgtccctcctgagtggttggctccaggaggaaaactgtataacctggcaaaaagtactcatggacagctgaggcctgacaaaaattacagctttcctttaaacaatttggtttgttcatatgatccagtgaaagatgttctgttaccagactatggattgagtaatctaacagcttgtaattggtgccatggcacatctgtgcgaagagtcagaggcgatggctctattgtatatttggatggagacagaactaattctaggtctactggtggcaaatgtggttgtggattcaaacacttttgggaaggtaaagaatatgacaaccttccagaagcttttcctatcactttggagtggggaggaagagtagtcagagaaacagtatattggttccagtatgaaagtgatccatctttgaatagtaatgtttatgatgttgcaatgaaacttgttaccaagcactttccaggtgaatttgggagtgagatcctagttcagaaagttgtccacactatattgcatcagactgcaaaaaaaaatcctgacgattacactcctgtaaatatagatggtgctcatgctcagagaattggagatgtgcaaggacaagaattggagtctcagctaccaactaaaattattcttactggacagaaaacaaaaactttgcacaaggaagaattaaacatgagtaaaactgaaagaactattcaacagaacatcacagaacaagcttctgtgatgcagaaacggaaaacagagaaattaaaacaagagcaaaaggggcaacccagaactgtttctccaagtactattcgtgatgggccttcatctgcacctgccacccccacgaaggctccctactcacctaccacttctaaggagaagaagattcgcataacaactaatgatggacggcagtccatggttacccttaagtcttcaacaaccttttttgaacttcaggaaagtatagccagagagttcaacattcctccatatttacagtgtattcgatatggttttcctcctaaagagttaatgccaccccaagcaggaatggaaaaggagccagttcctttgcagcatggtgacagaattaccatagagatcttaaaaggcaaagcagaaggtggtccatccactgctgcacactcagcccacactgtgagacaagaagagattgctgttactggcaagctgtcctccaaggaacttcaggagcaagctgacaaagaaatgtattccttgtgtcttttagcaacattaatgggagaagacgtgtggtcttatgcaaagggacttcctcacatgttccagcagggtggtgtattctacaatattatgaagaaaactatgggcatggctgatggcaaacattgtacttttccacatctacctggcaaaacctttgtttataatgcttctgaagacagactggagttgtgtgtcgatgccgcaggacatttccccattggtcctgatgttgaagatttagttaaagaggctgtaagtcaggttcgagcagaggctactacaagaagtagggaatcaagcccttcacatgggttattaaaactaggtagtggtggagtagtgaaaaagaagtctgagcaacttcacaatgtaactgcctttcaggggaagggccattctctaggaactgcatccagtaacccgcacatggatcccagagctagggaaactctggctgtaagaaagcataatacagggacagattttagtaatagttccattaaaacagagcctcctgtgttcacagctgcttctagtaatagtgagcttattcgaatagctcctggagtggtaacaatgagagatggtaggcagattgatcccgatgtggttgaggcccagcgaaaaaaattgcaggaaatggtttcttctattcaggcatcaatggacaagcacttgcgggatcaaagtacagagcaaacaccatctgatctttctcaaagaaaagtagaagctgtgagttcttctgtgaggcctgggaatcttcagactggcttgcctgaatctttttctttaactggtggcactgagaatttgaatactgaaacaactgatagtcgtgtagcagatgtactgggagcagcatttgccacaaggtcaaaagcacaaaaagaaaattccatggaggaacctgaagagatggatagtcaagatgctgagacaactaacacaactgagccgatggatcactcttgatttaatttagaggctaataaaggcagatgtttattgtgaatatgtaatatttgttggctgggccacataacttgagtagtc
//
by
@meso_cacase at
DBCLS
This page is licensed under a
Creative Commons Attribution 4.0 International License (CC BY 4.0).
If you use GGRNA in your work, please cite:
Naito Y, Bono H. (2012)
GGRNA: an ultrafast, transcript-oriented search engine for genes and transcripts.
Nucleic Acids Res., 40, W592-W596.
[Full Text]