2024-05-06 02:50:52, GGRNA.v2 : RefSeq release 222 (Jan, 2024)
LOCUS NR_037338 97 bp RNA linear ROD 28-NOV-2021 DEFINITION Rattus norvegicus microRNA let7f-1 (Mirlet7f-1), microRNA. ACCESSION NR_037338 VERSION NR_037338.1 KEYWORDS RefSeq. SOURCE Rattus norvegicus (Norway rat) ORGANISM Rattus norvegicus Eukaryota; Metazoa; Chordata; Craniata; Vertebrata; Euteleostomi; Mammalia; Eutheria; Euarchontoglires; Glires; Rodentia; Myomorpha; Muroidea; Muridae; Murinae; Rattus. REFERENCE 1 (bases 1 to 97) AUTHORS Gu QH, Yu D, Hu Z, Liu X, Yang Y, Luo Y, Zhu J and Li Z. TITLE miR-26a and miR-384-5p are required for LTP maintenance and spine enlargement JOURNAL Nat Commun 6, 6789 (2015) PUBMED 25858512 REMARK Publication Status: Online-Only REFERENCE 2 (bases 1 to 97) AUTHORS Li,C.J., Cheng,P., Liang,M.K., Chen,Y.S., Lu,Q., Wang,J.Y., Xia,Z.Y., Zhou,H.D., Cao,X., Xie,H., Liao,E.Y. and Luo,X.H. TITLE MicroRNA-188 regulates age-related switch between osteoblast and adipocyte differentiation JOURNAL J Clin Invest 125 (4), 1509-1522 (2015) PUBMED 25751060 REFERENCE 3 (bases 1 to 97) AUTHORS Polikepahad S and Corry DB. TITLE Profiling of T helper cell-derived small RNAs reveals unique antisense transcripts and differential association of miRNAs with argonaute proteins 1 and 2 JOURNAL Nucleic Acids Res 41 (2), 1164-1177 (2013) PUBMED 23185045 REFERENCE 4 (bases 1 to 97) AUTHORS Pogribny IP, Starlard-Davenport A, Tryndyak VP, Han T, Ross SA, Rusyn I and Beland FA. TITLE Difference in expression of hepatic microRNAs miR-29c, miR-34a, miR-155, and miR-200b is associated with strain-specific susceptibility to dietary nonalcoholic steatohepatitis in mice JOURNAL Lab Invest 90 (10), 1437-1446 (2010) PUBMED 20548288 REFERENCE 5 (bases 1 to 97) AUTHORS Linsen SE, de Wit E, de Bruijn E and Cuppen E. TITLE Small RNA expression and strain specificity in the rat JOURNAL BMC Genomics 11, 249 (2010) PUBMED 20403161 REMARK Publication Status: Online-Only REFERENCE 6 (bases 1 to 97) AUTHORS Mizuno Y, Tokuzawa Y, Ninomiya Y, Yagi K, Yatsuka-Kanesaki Y, Suda T, Fukuda T, Katagiri T, Kondoh Y, Amemiya T, Tashiro H and Okazaki Y. TITLE miR-210 promotes osteoblastic differentiation through inhibition of AcvR1b JOURNAL FEBS Lett 583 (13), 2263-2268 (2009) PUBMED 19520079 REFERENCE 7 (bases 1 to 97) AUTHORS Griffiths-Jones S, Grocock RJ, van Dongen S, Bateman A and Enright AJ. TITLE miRBase: microRNA sequences, targets and gene nomenclature JOURNAL Nucleic Acids Res 34 (Database issue), D140-D144 (2006) PUBMED 16381832 COMMENT PROVISIONAL REFSEQ: This record is based on preliminary annotation provided by NCBI staff in collaboration with miRBase. The reference sequence was derived from JACYVU010000288.1. Summary: microRNAs (miRNAs) are short (20-24 nt) non-coding RNAs that are involved in post-transcriptional regulation of gene expression in multicellular organisms by affecting both the stability and translation of mRNAs. miRNAs are transcribed by RNA polymerase II as part of capped and polyadenylated primary transcripts (pri-miRNAs) that can be either protein-coding or non-coding. The primary transcript is cleaved by the Drosha ribonuclease III enzyme to produce an approximately 70-nt stem-loop precursor miRNA (pre-miRNA), which is further cleaved by the cytoplasmic Dicer ribonuclease to generate the mature miRNA and antisense miRNA star (miRNA*) products. The mature miRNA is incorporated into a RNA-induced silencing complex (RISC), which recognizes target mRNAs through imperfect base pairing with the miRNA and most commonly results in translational inhibition or destabilization of the target mRNA. The RefSeq represents the predicted microRNA stem-loop. [provided by RefSeq, Sep 2009]. Sequence Note: This record represents a predicted microRNA stem-loop as defined by miRBase. Some sequence at the 5' and 3' ends may not be included in the intermediate precursor miRNA produced by Drosha cleavage. PRIMARY REFSEQ_SPAN PRIMARY_IDENTIFIER PRIMARY_SPAN COMP 1-97 JACYVU010000288.1 1559864-1559960 c FEATURES Location/Qualifiers source 1..97 /organism="Rattus norvegicus" /mol_type="transcribed RNA" /strain="BN" /db_xref="taxon:10116" /chromosome="17" /map="17p14" gene 1..97 /gene="Mirlet7f-1" /gene_synonym="Mir3596d; Mirlet7f1; rno-mir-3596d" /note="microRNA let7f-1" /db_xref="GeneID:100526574" /db_xref="miRBase:MI0015418" /db_xref="RGD:4888607" precursor_RNA 1..97 /gene="Mirlet7f-1" /gene_synonym="Mir3596d; Mirlet7f1; rno-mir-3596d" /product="microRNA let7f-1" /db_xref="GeneID:100526574" /db_xref="miRBase:MI0015418" /db_xref="RGD:4888607" exon 1..97 /gene="Mirlet7f-1" /gene_synonym="Mir3596d; Mirlet7f1; rno-mir-3596d" /inference="alignment:Splign:2.1.0" ncRNA 67..86 /ncRNA_class="miRNA" /gene="Mirlet7f-1" /gene_synonym="Mir3596d; Mirlet7f1; rno-mir-3596d" /product="rno-miR-3596d" /db_xref="miRBase:MIMAT0017823" /db_xref="GeneID:100526574" /db_xref="miRBase:MI0015418" /db_xref="RGD:4888607" ORIGIN
actcctcagggaaggcaatagattgtatagttatctcctaaacagggtaaaatcactaccccacaactatacaatctactacctcactctgatagag
//
by
@meso_cacase at
DBCLS
This page is licensed under a
Creative Commons Attribution 4.0 International License (CC BY 4.0).
If you use GGRNA in your work, please cite:
Naito Y, Bono H. (2012)
GGRNA: an ultrafast, transcript-oriented search engine for genes and transcripts.
Nucleic Acids Res., 40, W592-W596.
[Full Text]