LOCUS       NM_181367               1298 bp    mRNA    linear   ROD 22-MAR-2023
DEFINITION  Rattus norvegicus LIM homeobox 9 (Lhx9), mRNA.
ACCESSION   NM_181367 XM_001066548
VERSION     NM_181367.2
KEYWORDS    RefSeq; RefSeq Select.
SOURCE      Rattus norvegicus (Norway rat)
  ORGANISM  Rattus norvegicus
            Eukaryota; Metazoa; Chordata; Craniata; Vertebrata; Euteleostomi;
            Mammalia; Eutheria; Euarchontoglires; Glires; Rodentia; Myomorpha;
            Muroidea; Muridae; Murinae; Rattus.
REFERENCE   1  (bases 1 to 1298)
  AUTHORS   Molle B, Pere S, Failli V, Bach I and Retaux S.
  TITLE     Lhx9 and lhx9alpha: differential biochemical properties and effects
            on neuronal differentiation
  JOURNAL   DNA Cell Biol 23 (11), 761-768 (2004)
   PUBMED   15585134
  REMARK    GeneRIF: Lhx9 and Lhx9alpha isoforms could be implicated in
            regulating various aspects of neuronal differentiation
REFERENCE   2  (bases 1 to 1298)
  AUTHORS   Mazaud S, Oreal E, Guigon CJ, Carre-Eusebe D and Magre S.
  TITLE     Lhx9 expression during gonadal morphogenesis as related to the
            state of cell differentiation
  JOURNAL   Gene Expr Patterns 2 (3-4), 373-377 (2002)
   PUBMED   12617828
REFERENCE   3  (bases 1 to 1298)
  AUTHORS   Birk OS, Casiano DE, Wassif CA, Cogliati T, Zhao L, Zhao Y,
            Grinberg A, Huang S, Kreidberg JA, Parker KL, Porter FD and
            Westphal H.
  TITLE     The LIM homeobox gene Lhx9 is essential for mouse gonad formation
  JOURNAL   Nature 403 (6772), 909-913 (2000)
   PUBMED   10706291
COMMENT     PROVISIONAL REFSEQ: This record has not yet been subject to final
            NCBI review. The reference sequence was derived from AY273890.1.
            
            On or before Jun 25, 2006 this sequence version replaced
            XM_001066548.1, NM_181367.1.
            
            ##Evidence-Data-START##
            Transcript exon combination :: AY273890.1, AY724502.1 [ECO:0000332]
            RNAseq introns              :: single sample supports all introns
                                           SAMN14984036, SAMN14984043
                                           [ECO:0000348]
            ##Evidence-Data-END##
            
            ##RefSeq-Attributes-START##
            RefSeq Select criteria :: based on conservation
            ##RefSeq-Attributes-END##
FEATURES             Location/Qualifiers
     source          1..1298
                     /organism="Rattus norvegicus"
                     /mol_type="mRNA"
                     /db_xref="taxon:10116"
                     /chromosome="13"
                     /map="13q13"
     gene            1..1298
                     /gene="Lhx9"
                     /note="LIM homeobox 9"
                     /db_xref="GeneID:289048"
                     /db_xref="RGD:727956"
     exon            1..82
                     /gene="Lhx9"
                     /inference="alignment:Splign:2.1.0"
     misc_feature    58..60
                     /gene="Lhx9"
                     /note="upstream in-frame stop codon"
     exon            83..154
                     /gene="Lhx9"
                     /inference="alignment:Splign:2.1.0"
     CDS             127..1293
                     /gene="Lhx9"
                     /note="LIM homeobox protein 9; LIM-homeodomain type
                     transcription factor 9"
                     /codon_start=1
                     /product="LIM/homeobox protein Lhx9"
                     /protein_id="NP_852032.1"
                     /db_xref="GeneID:289048"
                     /db_xref="RGD:727956"
                     /translation="

MLNGTTLEAAMLFHGISGGHIQGIMEEMERRSKTEARLAKGTQLNGRDAGMPPLSPEKPALCAGCGGKISDRYYLLAVDKQWHLRCLKCCECKLALESELTCFAKDGSIYCKEDYYRRFSVQRCARCHLGISASEMVMRARDSVYHLSCFTCSTCNKTLTTGDHFGMKDSLVYCRAHFETLLQGEYPPQLSYTELAAKSGGLALPYFNGTGTVQKGRPRKRKSPALGVDIVNYNSGCNENEADHLDRDQQPYPPSQKTKRMRTSFKHHQLRTMKSYFAINHNPDAKDLKQLAQKTGLTKRVLQVWFQNARAKFRRNLLRQENGGVDKADGTSLPAPPSADSGALTPPGTATTLTDLTNPTVTVVTTVTSNMDSHESGSPSQTTLTNLF"

     misc_feature    280..471
                     /gene="Lhx9"
                     /note="The first LIM domain of Lhx2; Region: LIM1_Lhx2;
                     cd09469"
                     /db_xref="CDD:188853"
     misc_feature    order(310..312,319..321,373..375,382..384,391..393,
                     400..402,457..459,466..468)
                     /gene="Lhx9"
                     /note="Zn binding site [ion binding]; other site"
                     /db_xref="CDD:188853"
     misc_feature    484..660
                     /gene="Lhx9"
                     /note="The second LIM domain of Lhx2 and Lhx9 family;
                     Region: LIM2_Lhx2_Lhx9; cd09377"
                     /db_xref="CDD:188763"
     misc_feature    order(496..498,505..507,562..564,571..573,580..582,
                     589..591,646..648,655..657)
                     /gene="Lhx9"
                     /note="Zn binding site [ion binding]; other site"
                     /db_xref="CDD:188763"
     misc_feature    841..915
                     /gene="Lhx9"
                     /note="propagated from UniProtKB/Swiss-Prot (Q80W90.1);
                     Region: Disordered. /evidence=ECO:0000256|SAM:MobiDB-lite"
     misc_feature    order(901..915,919..921,970..972,988..990,1027..1029,
                     1033..1038,1045..1050,1054..1062,1066..1071)
                     /gene="Lhx9"
                     /note="DNA binding site [nucleotide binding]"
                     /db_xref="CDD:238039"
     misc_feature    order(907..909,916..918,1036..1038,1045..1050,1057..1059)
                     /gene="Lhx9"
                     /note="specific DNA base contacts [nucleotide binding];
                     other site"
                     /db_xref="CDD:238039"
     misc_feature    910..1068
                     /gene="Lhx9"
                     /note="Homeobox domain; Region: Homeobox; pfam00046"
                     /db_xref="CDD:425441"
     misc_feature    1087..1194
                     /gene="Lhx9"
                     /note="propagated from UniProtKB/Swiss-Prot (Q80W90.1);
                     Region: Disordered. /evidence=ECO:0000256|SAM:MobiDB-lite"
     misc_feature    1231..1290
                     /gene="Lhx9"
                     /note="propagated from UniProtKB/Swiss-Prot (Q80W90.1);
                     Region: Disordered. /evidence=ECO:0000256|SAM:MobiDB-lite"
     exon            155..273
                     /gene="Lhx9"
                     /inference="alignment:Splign:2.1.0"
     exon            274..476
                     /gene="Lhx9"
                     /inference="alignment:Splign:2.1.0"
     exon            477..832
                     /gene="Lhx9"
                     /inference="alignment:Splign:2.1.0"
     exon            833..1035
                     /gene="Lhx9"
                     /inference="alignment:Splign:2.1.0"
     exon            1036..1298
                     /gene="Lhx9"
                     /inference="alignment:Splign:2.1.0"
ORIGIN      

ctgaccaccacctctggccacctcctctccaagaaccaaattcttgagaagaacgcctgacaccaagacgagaaacatcaagcacaaccgcatttcactgcgcggtccgctactcttgcacagagaatgctgaacggcaccactctagaggcagccatgctcttccacggaatctccggaggccacatccaaggtatcatggaggaaatggagcgcagatccaagaccgaggcccgtctggccaaaggcactcagctcaacggccgcgacgcgggtatgcccccgctcagccccgagaagcctgctctgtgcgccggctgcgggggtaagatctctgacaggtactatctgctggctgtagacaaacagtggcaccttaggtgcctgaagtgctgtgaatgtaagctggccctggaatcggagctcacctgctttgccaaggacggtagcatttactgcaaggaggattactacagaaggttctctgtgcagagatgtgcccgctgccaccttggcatttccgcctcggagatggtcatgcgcgcccgagactcagtctaccatctgagctgcttcacttgctccacttgcaacaagaccttgaccacgggcgaccatttcggtatgaaggacagcctggtatactgccgcgcacactttgagaccctcttgcaaggggaatatccacctcagctgagctacacggagctggcggccaagagcggcggcttagctctgccttacttcaatggcactggcacagtgcagaaggggcggccccggaagcggaagagcccagctctgggagtggacatcgtgaattacaactcaggttgtaatgagaacgaggcagaccatttggaccgggaccagcagccttacccaccttcccagaagaccaaacggatgcgaacttctttcaaacaccaccagcttcggaccatgaaatcctactttgccatcaaccataacccagatgccaaggacctcaaacagcttgctcaaaaaacaggcctgaccaaaagagttttgcaggtttggttccaaaacgcacgagccaaattcagaaggaaccttttgcggcaggagaatgggggtgttgataaagctgacggcacgtcgcttccggccccgccctcagcagacagcggcgctctcactccacccggcactgcgaccactttaacagacctgaccaatcccactgtcactgtagtgacaactgtgacctctaacatggacagccacgaatccggaagcccctcacaaactaccttaacgaaccttttctaacattg

//